G3767


Basic Information

Item Value
gene id G3767
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 21732491 ~ 21732699 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU4559
gaactagatgaagtaatgcatgagaaagacctaggagtctatgtggacgcctcactttctccatccaaacaatgtggggaagcaataaaaaaggcaaacagaatgctagggtatattgtcaaaagtgtagaattgagaacaagggcagtgatgttcagactgtacaatgcactagttagagctcatctggatactgtggacagttctgg

Function

NR:

description
PREDICTED: WD repeat and SOCS box-containing protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU4559 True 209 lncRNA 0.44 1 21732491 21732699

Neighbor

gene id symbol gene type direction distance location
AMCG00003847 NA coding upstream 196733 21491884 ~ 21535758 (+)
AMCG00003846 NA coding upstream 285370 21440114 ~ 21447121 (+)
AMCG00003845 NA coding upstream 293812 21348227 ~ 21438679 (+)
AMCG00003843 lama2 coding upstream 399267 21314074 ~ 21333224 (+)
AMCG00003844 lama2,LOC107653134 coding upstream 436273 21288460 ~ 21296218 (+)
AMCG00003854 NA coding downstream 124791 21857490 ~ 21862799 (+)
AMCG00003855 NA coding downstream 217632 21950331 ~ 21958985 (+)
AMCG00003856 NA coding downstream 237797 21970496 ~ 21981590 (+)
AMCG00003861 NA coding downstream 368589 22101288 ~ 22106730 (+)
AMCG00003873 NA coding downstream 742388 22475087 ~ 22498055 (+)
G3757 NA non-coding upstream 131631 21600632 ~ 21600860 (+)
G3754 NA non-coding upstream 134061 21595856 ~ 21598430 (+)
G3690 NA non-coding upstream 642237 21089595 ~ 21090254 (+)
G3670 NA non-coding upstream 804689 20925812 ~ 20927802 (+)
G3666 NA non-coding upstream 819503 20912142 ~ 20912988 (+)
G3770 NA non-coding downstream 17828 21750527 ~ 21759799 (+)
G3798 NA non-coding downstream 184577 21917276 ~ 22016452 (+)
G3845 NA non-coding downstream 344293 22076992 ~ 22077458 (+)
G3863 NA non-coding downstream 437641 22170340 ~ 22172105 (+)
G3871 NA non-coding downstream 450544 22183243 ~ 22184811 (+)
G3751 NA other upstream 182958 21549201 ~ 21549533 (+)
AMCG00003828 ctgf,ctgfa,moxd1,LOC106571301,LOC107683930,LOC106571350 other upstream 2334805 19271965 ~ 19397686 (+)
G3108 NA other upstream 3580177 18146660 ~ 18152314 (+)
AMCG00003779 ctsb,catb,LOC107381178 other upstream 3589858 18131919 ~ 18142633 (+)
G3047 NA other upstream 4048503 17681817 ~ 17683988 (+)
G3771 NA other downstream 13151 21745850 ~ 21760630 (+)
AMCG00003853 NA other downstream 157824 21890523 ~ 21901865 (+)
G3799 med23 other downstream 189937 21922636 ~ 21923787 (+)
AMCG00003874 NA other downstream 950317 22683016 ~ 22769227 (+)
AMCG00003884 NA other downstream 1599902 23332601 ~ 23338241 (+)

Expression


Co-expression Network