G5808


Basic Information

Item Value
gene id G5808
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 34381868 ~ 34382099 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU7148
taacatgccacaggttaacaaccagtccagtcaaaccctaagagagatcaggataaatgaggaggaggtactaaagggactagcagaattaaaaaccaacaaatcacctgggccagatgggatatttccaacagtacttaaataaattagggaaattatttataggccgctaactcaaatattccaaatgacacttagaacaggggatgtgccaactgactagaagacagca

Function

GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU7148 True 232 lncRNA 0.39 1 34381868 34382099

Neighbor

gene id symbol gene type direction distance location
AMCG00004122 NA coding upstream 248256 34131126 ~ 34133612 (+)
AMCG00004121 NA coding upstream 251845 34119571 ~ 34130023 (+)
AMCG00004115 NA coding upstream 468983 33905291 ~ 33912885 (+)
AMCG00004113 rhob,LOC105888539,LOC103025336,LOC105907285,LOC106607565 coding upstream 614232 33767046 ~ 33767636 (+)
AMCG00004110 NA coding upstream 620411 33747909 ~ 33761457 (+)
AMCG00004125 NA coding downstream 249122 34631221 ~ 34638669 (+)
AMCG00004124 klhl29,LOC107738561,LOC107678777 coding downstream 284293 34666392 ~ 34685790 (+)
AMCG00004126 klhl29,LOC107742703 coding downstream 313304 34695403 ~ 34724610 (+)
AMCG00004127 NA coding downstream 416290 34798389 ~ 34808422 (+)
AMCG00004128 NA coding downstream 438069 34820168 ~ 34834115 (+)
G5804 NA non-coding upstream 89367 34292271 ~ 34292501 (+)
G5788 NA non-coding upstream 291746 34081826 ~ 34090122 (+)
G5787 NA non-coding upstream 301083 34078351 ~ 34080785 (+)
G5768 NA non-coding upstream 488725 33892474 ~ 33893143 (+)
G5750 NA non-coding upstream 610020 33769589 ~ 33771848 (+)
G5867 NA non-coding downstream 512003 34894102 ~ 34895661 (+)
G5875 NA non-coding downstream 517537 34899636 ~ 35350027 (+)
G5914 NA non-coding downstream 919004 35301103 ~ 35306949 (+)
G6002 NA non-coding downstream 1073577 35455676 ~ 35455887 (+)
G6007 NA non-coding downstream 1083763 35465862 ~ 35466655 (+)
G5642 NA other upstream 1250682 33130120 ~ 33131186 (+)
AMCG00004079 NA other upstream 1979485 32400405 ~ 32402383 (+)
AMCG00004056 ypel5,LOC107568027,LOC103458748,LOC102788175,LOC102210471 other upstream 3487041 30887995 ~ 30894827 (+)
AMCG00004039 NA other upstream 4074693 30296867 ~ 30307175 (+)
G5245 NA other upstream 4110344 30271210 ~ 30271524 (+)
AMCG00004138 fkbp1b other downstream 470764 34852863 ~ 34870320 (+)
AMCG00004158 NA other downstream 1370351 35752450 ~ 35766180 (+)
AMCG00004160 LOC106571404,LOC106607809,LOC105897019 other downstream 1645180 36027279 ~ 36045282 (+)
AMCG00004167 NA other downstream 1879689 36261788 ~ 36278234 (+)
AMCG00004179 ptrhd1,LOC103399259 other downstream 2305531 36687630 ~ 36697885 (+)

Expression


Co-expression Network