AMCG00007435 (crybgx,LOC105906490,LOC103028443,LOC103368872,LOC107563446,LOC106562861)


Basic Information

Item Value
gene id AMCG00007435
gene name crybgx,LOC105906490,LOC103028443,LOC103368872,LOC107563446,LOC106562861
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 18570568 ~ 18573120 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007435
ATGAACATCTTTACTAAGGTCCCCGGATTTGCCCATCAAACCAGCAAGCTGGGGTCTGTGCTCCAACGTGCCTTCTACGGGTCCAGTGGACGGGTGACCCTGTATGAGCAGAGGAACTTCACTGGACGGAGACTGGACCTGACTGCGGACTGTCAGAAACTAACTGACAAGAACTTCCCGGAGAGATGCAACTCTGTGCAAGTGGAGAGCGGGGCCTGGGTGGGGTACGAGTATGAGAATTTCCATGGCCGCCAGTATCTGTGGGACATGTCTGACCGGGGCGAGTACAACAGCTGTGACAAGTGGTGTGCGTCTGTGGACCATGTGTCCTCTGTGCGCTCTGTCAGACAGGATACCTCCCCCCCCAGGCTGCAGATGTTCGAGCGGGCCGGCTTCTCCGGGAAGAAGACGGAACTCCAGGATGACGTCCCCAACCTCATGAACCGCTACAGCCTCAACCGCGCCTCATCCATCCGCGTCCTGGGAGGATGCTGGGTAGTCTACCAGGAACCCAACTACAGAGGCCCTCACTACATCCTAGAAAAGAAAGACTACAACAACTACTCTGACTGGGGCGGCCAGAACAGCACCCTGGGCTCCATCCGCAGGATCCGATTCAGCTGA

Function

symbol description
crybgx Predicted to be a structural constituent of eye lens. Predicted to be involved in lens development in camera-type eye and visual perception. Is expressed in lens.

NR:

description
PREDICTED: gamma-crystallin N-A-like

GO: NA

KEGG:

id description
K23483 CRYG; gamma-crystallin

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007435 True 624 mRNA 0.57 6 18570568 18573120

Neighbor

gene id symbol gene type direction distance location
AMCG00007434 NA coding downstream 67177 18496190 ~ 18503391 (-)
AMCG00007432 smad6 coding downstream 88038 18475150 ~ 18482530 (-)
AMCG00007431 LOC107393511,LOC101268919 coding downstream 142962 18427397 ~ 18427606 (-)
AMCG00007429 smad3,smad3a,LOC108430827,LOC107740443,LOC107553101 coding downstream 154120 18404221 ~ 18416448 (-)
AMCG00007430 NA coding downstream 173527 18362254 ~ 18397041 (-)
AMCG00007443 NA coding upstream 11679 18584799 ~ 18590127 (-)
AMCG00007441 map2k1 coding upstream 24155 18597275 ~ 18613946 (-)
AMCG00007442 NA coding upstream 51603 18624723 ~ 18633969 (-)
AMCG00007445 NA coding upstream 141495 18714615 ~ 18733019 (-)
AMCG00007449 NA coding upstream 218458 18791578 ~ 18810571 (-)
G23745 NA non-coding downstream 167291 18314151 ~ 18403277 (-)
G23676 NA non-coding downstream 496563 18072055 ~ 18074005 (-)
G23663 NA non-coding downstream 507576 17972906 ~ 18062992 (-)
G23629 NA non-coding downstream 664160 17906101 ~ 17906408 (-)
G23624 NA non-coding downstream 747250 17821767 ~ 17823318 (-)
G23799 NA non-coding upstream 46165 18619285 ~ 18620731 (-)
G23813 NA non-coding upstream 138957 18712077 ~ 18714368 (-)
G23839 NA non-coding upstream 204725 18777845 ~ 18778069 (-)
G23840 NA non-coding upstream 206051 18779171 ~ 18779608 (-)
G23842 NA non-coding upstream 207717 18780837 ~ 18781092 (-)
AMCG00007418 fem1b other downstream 362548 18202459 ~ 18208020 (-)
G23661 NA other downstream 511619 18055470 ~ 18058949 (-)
AMCG00007375 NA other downstream 1948663 16469467 ~ 16621905 (-)
AMCG00007365 cars,LOC107578099,LOC102789774 other downstream 2224988 16320997 ~ 16345580 (-)
AMCG00007366 NA other downstream 2256536 16237461 ~ 16314032 (-)
G23838 NA other upstream 203240 18776360 ~ 18777638 (-)
AMCG00007481 fam63b,LOC107750498 other upstream 1218581 19791701 ~ 19799752 (-)
AMCG00007487 NA other upstream 1342026 19915146 ~ 19923153 (-)
AMCG00007494 NA other upstream 1598209 20171329 ~ 20222004 (-)
G24217 NA other upstream 1758393 20331513 ~ 20331811 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_034880 crybgx coding NC_007118.7 CM002891.2 34222433 ~ 34225011 (-)
grasscarp (Ctenopharyngodon idella) CI01000026_07707119_07710156 CRYBGX coding CI01000026 null 7707016 ~ 7710744 (-)
striped catfish (Pangasianodon hypophthalmus) crybgx crybgx,LOC108259467,LOC107563446,LOC103368872,LOC102304589,LOC103028443,LOC105906490,LOC107553105,LOC107755101 misc NC_047619.1 CM018565.1 7699701 ~ 7702517 (-)