AMCG00011213 (LOC106567451,LOC106603869,LOC107661726,LOC108441632,LOC107713183,LOC107662844,LOC107587249)


Basic Information

Item Value
gene id AMCG00011213
gene name LOC106567451,LOC106603869,LOC107661726,LOC108441632,LOC107713183,LOC107662844,LOC107587249
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 14095155 ~ 14096053 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00011213
ATGATGGGTCCTGCTTTTCCCTTCTTTCGTCCGCAGGTCACGATCCTCATTTTCCTGGCCCTGGCATTCCTTGCTTGTATAGTGTTCTTGGTGGTATACAAGGCCTTCACCTATGATCACAGCTGCCCAGACGGATTTGTGTACAAGCACAAGCGCTGTATCCCTGCTTCCCTTGAGGCCTATTACTCTGCTCAGGACTCCAACACGCGAGGCCGTTTCTACACTGTCATCAGCCACTACAGCATGGCCAAGCAGACCACCTCCCGCTCCGTCTCCCCCTGGCTCCCCGCGGGCGCCGCCGACCACGACGCCAAAGCTCCTAATACCGAGGGCCACTGA

Function

NR:

description
PREDICTED: neuron-specific protein family member 2-like

GO:

id name namespace
GO:0007212 dopamine receptor signaling pathway biological_process
GO:0048268 clathrin coat assembly biological_process
GO:0016021 integral component of membrane cellular_component
GO:0032051 clathrin light chain binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00011213 True 339 mRNA 0.57 2 14095155 14096053

Neighbor

gene id symbol gene type direction distance location
AMCG00011212 NA coding upstream 18738 14072368 ~ 14076417 (+)
AMCG00011206 sec20,bnip1b,LOC105011259,LOC106603874,LOC106567448,LOC107727279,LOC108441621,LOC107587246 coding upstream 180969 13909732 ~ 13914186 (+)
AMCG00011205 crebrf,LOC106603875 coding upstream 195117 13891754 ~ 13900038 (+)
AMCG00011201 rpl26l1,rl26,LOC103040128,LOC100708525,LOC105024418,LOC107697626 coding upstream 227810 13864615 ~ 13867345 (+)
AMCG00011202 pcyox1l,LOC107581983,LOC103475662 coding upstream 240311 13851441 ~ 13854844 (+)
AMCG00011214 NA coding downstream 100482 14196535 ~ 14196906 (+)
AMCG00011217 NA coding downstream 191703 14287756 ~ 14305622 (+)
AMCG00011215 sfxn1 coding downstream 270387 14366440 ~ 14379806 (+)
AMCG00011219 LOC103361792,LOC102209146 coding downstream 300729 14396782 ~ 14411016 (+)
AMCG00011220 NA coding downstream 323675 14419728 ~ 14426630 (+)
G105051 NA non-coding upstream 24186 14070400 ~ 14070969 (+)
G105046 NA non-coding upstream 31998 14062700 ~ 14063157 (+)
G104980 NA non-coding upstream 236173 13858651 ~ 13858982 (+)
G104979 NA non-coding upstream 236963 13857831 ~ 13858192 (+)
G104923 NA non-coding upstream 415775 13665947 ~ 13679380 (+)
G105078 LOC103376870 non-coding downstream 122897 14218950 ~ 14262016 (+)
G105113 NA non-coding downstream 360049 14456102 ~ 14459018 (+)
G105143 NA non-coding downstream 568567 14664620 ~ 14665153 (+)
G105144 NA non-coding downstream 574666 14670719 ~ 14670928 (+)
G105145 atp10d,atp10b non-coding downstream 575245 14671298 ~ 14671549 (+)
AMCG00011209 cpeb4,LOC106603870 other upstream 34128 14013121 ~ 14061027 (+)
AMCG00011210 bod1,LOC107581912,LOC107661728,LOC107713186,LOC107662284,LOC107587245,LOC108278584,LOC106603873 other upstream 102310 13985665 ~ 13992845 (+)
AMCG00011204 NA other upstream 216873 13868337 ~ 13878282 (+)
G104815 slc23a1,pwwp2a,LOC106603911,LOC102781148 other upstream 1152073 12942380 ~ 12943082 (+)
AMCG00011163 reep2,LOC107557670,LOC107588406 other upstream 1415726 12670376 ~ 12679429 (+)
G105139 LOC100846954 other downstream 523637 14619690 ~ 14620534 (+)
AMCG00011241 LOC102221627,LOC107740141,LOC107680337,LOC107593202 other downstream 1224727 15320780 ~ 15322658 (+)
AMCG00011250 NA other downstream 1376206 15472259 ~ 15487372 (+)
AMCG00011253 NA other downstream 1754593 15850646 ~ 15852389 (+)
AMCG00011252 NA other downstream 1757711 15853764 ~ 15855784 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_019826 nsg2 coding NC_007132.7 CM002905.2 41256771 ~ 41305748 (-)
grasscarp (Ctenopharyngodon idella) CI01000040_03603080_03639966 HMP19 coding CI01000040 null 3603080 ~ 3639966 (-)