AMCG00017511



Basic Information


Item Value
gene id AMCG00017511
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 8175730 ~ 8177002 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00017511
ATGTCGAGATCCTTCTACGTCGATTCACTGATCATCAAAGACACTGCCAGACCGGCGCCTTTGAGCGAGCACACTGGACAAGATTTCCTCATCCCCATAAGCATGCACTCCCCCAGCGTCATGACCGTCTCCGCACCGGTGTGTCCTTCAAGGAAAAGCGGCACGTTTTGTGTGTGCCCTCTCTGTGTCACGTCTCACATCCACTCTCCGCGGAACAGCATCCCTCTGCTCAAGAGCCAGTTCCCAGGTGGGGAGCCCCAATACTGTCAGAGGATGGGACATCAGCCGAGCCCCGGCATGGGCCATCCAGGACACGCACCTGTCTGCACCCCCACCTACAGCGTCACGGATCCCAGGAGGTATCACTGCCTCTCATTGGGTCGGAAGATGAAGAATCACTATCCCCCGGGTCAGCCACAGAAGAAAAAGAGATTTCACCTATTTAAAGCAATCCCAGAAGCGTTTAAAGACCTACACTTGTTCCTGTCCCCTGCACTTACTCTTCCCGAAACATGA

Function


GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG:

id description
K09310 GSH; homeobox protein GSH

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00017511 True 516 mRNA 0.55 2 8175730 8177002

Neighbor


gene id symbol gene type direction distance location
AMCG00017509 NA coding upstream 152602 7992115 ~ 8023128 (+)
AMCG00017510 NA coding upstream 340517 7830998 ~ 7835213 (+)
AMCG00017503 NA coding upstream 463536 7702114 ~ 7712194 (+)
AMCG00017495 NA coding upstream 508655 7663708 ~ 7667075 (+)
AMCG00017493 NA coding upstream 517605 7655383 ~ 7658125 (+)
AMCG00017514 pdgfra coding downstream 14785 8191787 ~ 8212616 (+)
AMCG00017515 NA coding downstream 70957 8247959 ~ 8282506 (+)
AMCG00017518 NA coding downstream 183178 8360180 ~ 8376658 (+)
AMCG00017517 tmem165,LOC106584122 coding downstream 199822 8376824 ~ 8381670 (+)
AMCG00017525 NA coding downstream 383130 8560132 ~ 8565811 (+)
G90924 NA non-coding upstream 185770 7989696 ~ 7989960 (+)
G90922 NA non-coding upstream 207402 7968120 ~ 7968328 (+)
G90921 NA non-coding upstream 209122 7966320 ~ 7966608 (+)
G90919 NA non-coding upstream 212454 7963043 ~ 7963276 (+)
G90917 NA non-coding upstream 253090 7922192 ~ 7922640 (+)
G90991 NA non-coding downstream 52313 8229315 ~ 8229576 (+)
G91004 NA non-coding downstream 109290 8286292 ~ 8286728 (+)
G91104 NA non-coding downstream 555366 8732368 ~ 8732632 (+)
G91128 NA non-coding downstream 606865 8783867 ~ 8784089 (+)
G91135 NA non-coding downstream 642711 8819713 ~ 8824837 (+)
G90955 NA other upstream 42876 8132368 ~ 8132854 (+)
AMCG00017508 NA other upstream 362091 7806378 ~ 7813639 (+)
G90881 NA other upstream 482383 7692585 ~ 7693347 (+)
G90877 NA other upstream 503880 7668183 ~ 7671850 (+)
AMCG00017486 NA other upstream 987087 6729738 ~ 7188643 (+)
AMCG00017526 paics,LOC107555752 other downstream 510695 8687697 ~ 8700754 (+)
AMCG00017527 tkfc,LOC107731922,LOC107095500 other downstream 574711 8751713 ~ 8764903 (+)
G91281 LOC103376870 other downstream 1342771 9519773 ~ 9583280 (+)
G91452 cc2d2a other downstream 3702612 11879614 ~ 11880499 (+)
AMCG00017600 NA other downstream 5019893 13196895 ~ 13259760 (+)

Expression



Co-expression Network