G99598 (ppp2ca,LOC107750370,LOC108439805,LOC107594878,LOC105026079)


Basic Information

Item Value
gene id G99598
gene name ppp2ca,LOC107750370,LOC108439805,LOC107594878,LOC105026079
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056712.1
NCBI id CM032081.1
chromosome length 26701998
location 13313874 ~ 13314341 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU147297
TGCGTGTCTACGAGGGCCGTAAGAGGAAGGTAGTCAAAGAGGTCTGTGAAATACTTCCAAACGTTTGCGTTTCCGTATTTTCTCAGGCACTCGTCATAAAAACCATAAACCTGCGTGATCTGTCTACTTTCGTGATTTCCACGGAGGATGGTGATTCTCTCTCGATACCGAACCTGGGCGATCTTTAGAGACACCAGCAGGGTGACGGTCTCTACTGAATAGTAGCCTCTGTCCACATAGTCTCCCATGAAAAGGTAATTAGTATCCGGTGACTTGCCCCCGATCTTAAACAGTTCCATAAGATCGTGAAATTGACCGTGCACATCTCCACATACCGTGACGGGGCAGCGCACCTCCTGAACGTTTGACTCTTTGGATAAAATTTCTTTAGC

Function

symbol description
ppp2ca Enables protein heterodimerization activity and protein serine/threonine phosphatase activity. Involved in negative regulation of epithelial to mesenchymal transition; peptidyl-threonine dephosphorylation; and positive regulation of protein serine/threonine kinase activity. Located in membrane raft. Part of protein phosphatase type 2A complex. Biomarker of Parkinson's disease; congestive heart failure; and prostate cancer.

NR:

description
PREDICTED: serine/threonine-protein phosphatase 2A catalytic subunit alpha isoform-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU147297 True 392 lncRNA 0.47 2 13313874 13314341

Neighbor

gene id symbol gene type direction distance location
si:ch1073-44g3.1 si:ch1073-44g3.1,LOC107594879,LOC107668575,LOC107594921,LOC107680608,LOC107749736,LOC107750371 coding downstream 2219 13309642 ~ 13311655 (-)
nsd1a LOC107680604,LOC107750369,LOC107749737,LOC107668568,LOC107594938 coding downstream 5763 13290142 ~ 13308111 (-)
rmnd5b rmnd5b,LOC107594922,LOC107653309,LOC107750367,LOC107749738,LOC105026275,LOC100306854 coding downstream 24652 13281241 ~ 13289222 (-)
tnip1 LOC107750363,LOC107594924,LOC107749743,LOC107680584,LOC107594886 coding downstream 84937 13217270 ~ 13228937 (-)
dctn4 dctn4,LOC107749746,LOC107750360 coding downstream 102738 13204109 ~ 13211136 (-)
zdhhc5b zdhhc5b,zdhhc5,LOC107750372,LOC107594917,LOC107680622 coding upstream 20854 13335195 ~ 13347925 (-)
clp1 clp1,LOC107680590,LOC107750374,LOC107594950,LOC107749782,LOC107668570 coding upstream 33759 13348100 ~ 13351652 (-)
mif mif,LOC107680670,LOC107594949,LOC107594906,LOC107668577 coding upstream 40223 13354564 ~ 13356211 (-)
zgc:154054 zgc:154054,LOC107756453,LOC107680635,LOC107668581,LOC107749726,LOC107594900,LOC107594937 coding upstream 51276 13365617 ~ 13376513 (-)
LOC122357760 LOC107594915,LOC107680637,LOC107756454,LOC107749725 coding upstream 65368 13379709 ~ 13381003 (-)
G99410 NA non-coding downstream 501692 12810377 ~ 12812182 (-)
G99426 NA non-coding downstream 553684 12759801 ~ 12760190 (-)
G99385 LOC107750342,LOC107587096,LOC107677374 non-coding downstream 938249 12374783 ~ 12375625 (-)
G99355 NA non-coding downstream 1015967 12232307 ~ 12297907 (-)
G99277 NA non-coding downstream 1250394 12063259 ~ 12063480 (-)
G99599 NA non-coding upstream 124 13314465 ~ 13315683 (-)
G99605 LOC107680631,LOC107756456,LOC107594913,LOC107668579,LOC107749722,LOC107594868 non-coding upstream 79060 13393401 ~ 13396160 (-)
LOC122357200 NA non-coding upstream 216959 13531300 ~ 13532865 (-)
G99611 NA non-coding upstream 259484 13573825 ~ 13586152 (-)
G99650 NA non-coding upstream 455259 13769600 ~ 13770587 (-)
anxa6 LOC107750364,LOC107680661,LOC107749741,LOC107653312 other downstream 66947 13232863 ~ 13246927 (-)
LOC122357294 LOC107594926,LOC107750359,LOC107653319,LOC107749747,LOC107680586,LOC107594904 other downstream 110065 13155345 ~ 13203809 (-)
LOC122358015 LOC107750354,LOC107677359,LOC107594929 other downstream 504313 12804411 ~ 12809561 (-)
higd2a LOC107653333,LOC107749757,LOC107595747,LOC107594954,LOC107677392,LOC107750386 other downstream 545802 12764271 ~ 12768072 (-)
atp6v0e1 atp6v0e1,LOC106604294 other downstream 1417242 11894379 ~ 11896632 (-)
LOC122357887 selenoh,LOC107712321 other upstream 260136 13574477 ~ 13575834 (-)
LOC122357202 qdpr,qdpra,LOC107741111,LOC107550873,LOC107756464,LOC107694980,LOC107680669,LOC107601489 other upstream 877467 14191808 ~ 14193614 (-)
anxa5a anxa5a,LOC107680595,LOC107756438,LOC107741566,LOC107601470,LOC107550841,LOC108424145 other upstream 1138948 14453289 ~ 14461359 (-)
cryba1l1 cryba1l1,LOC107575843,LOC107741220,LOC107680648,LOC105891496,LOC103035187,LOC101160002,LOC103354768 other upstream 1169637 14483978 ~ 14486278 (-)
G99814 mgst2,LOC107756475,LOC107680678,LOC107676517,LOC107579102 other upstream 1193056 14507397 ~ 14510070 (-)

Expression


Co-expression Network