G11467


Basic Information

Item Value
gene id G11467
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 17915550 ~ 17917303 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU12660
GGAAGTCAGGAGACCCTCCCTCTGCTCATCTTGTCCTTTGAGACATGTCAGCACCAGAGACAGGAAGGGCTGCTGGCTCAAGAGAGACATACTTTTTTTGTTTCTGCCGATCTCTTTCTTTTCGTGAGGAGGGTCCCAGGTGCTGCCCCTTCTCCAGCTCTTCGCCCGCAGCCTTCAGCACGTGACCCTGCACCGAGGTGTGCAGCTTACCAATCAGAGGGGCCACTAACCAGACACCTGAACGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU12660 True 246 lncRNA 0.56 2 17915550 17917303

Neighbor

gene id symbol gene type direction distance location
CI01000000_17897786_17904428 MARS2 coding upstream 10981 17897728 ~ 17904569 (+)
CI01000000_17858551_17862300 FGF1A coding upstream 53230 17856808 ~ 17862320 (+)
CI01000000_17831876_17854247 NR3C1 coding upstream 61117 17830760 ~ 17854433 (+)
CI01000000_17729584_17730495 NA coding upstream 184951 17729584 ~ 17730599 (+)
CI01000000_17672091_17673742 MSX2A coding upstream 240408 17671672 ~ 17675142 (+)
CI01000000_18144240_18154922 NA coding downstream 225806 18143109 ~ 18155084 (+)
CI01000000_18441823_18447239 NA coding downstream 523145 18440448 ~ 18447454 (+)
CI01000000_18586406_18593775 NA coding downstream 669103 18586406 ~ 18593775 (+)
CI01000000_18651815_18661568 FBXL21 coding downstream 734187 18651490 ~ 18661655 (+)
CI01000000_18785690_18788783 NUDCD2 coding downstream 868060 18785363 ~ 18789045 (+)
G11465 NA non-coding upstream 28088 17883953 ~ 17887462 (+)
G11484 NA non-coding upstream 39942 17875312 ~ 17875608 (+)
G11443 NA non-coding upstream 119227 17796110 ~ 17796323 (+)
G11442 NA non-coding upstream 142746 17772453 ~ 17772804 (+)
G11441 NA non-coding upstream 144303 17770852 ~ 17771247 (+)
G11506 NA non-coding downstream 49005 17966308 ~ 17980652 (+)
G11513 NA non-coding downstream 67479 17984782 ~ 17990620 (+)
G11518 NA non-coding downstream 136825 18054128 ~ 18059456 (+)
G11589 NA non-coding downstream 206461 18123764 ~ 18166384 (+)
G11669 NA non-coding downstream 322320 18239623 ~ 18269824 (+)
CI01000000_17339270_17345013 CXCL14, CXL14 other upstream 569350 17339154 ~ 17346200 (+)
G10201 NA other upstream 1984988 15930266 ~ 15930562 (+)
G9201 NA other upstream 3680609 14215024 ~ 14234941 (+)
G7522 NA other upstream 5736542 12178369 ~ 12179008 (+)
G11521 NA other downstream 115436 18032739 ~ 18164112 (+)
G11801 NA other downstream 763564 18674116 ~ 18745376 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
tiger barb (Puntius tetrazona) G100995 NA non-coding NC_056712.1 CM032081.1 19669078 ~ 19670275 (+)