G12568


Basic Information

Item Value
gene id G12568
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 183180 ~ 183382 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU13922
GCCTGTTTGAGTTGCACGGACAGCTCATTTGACCGCATGACGTGGGTTCACAGCAACGGATTCCAAATGAAAATGCCACTCTGAGAATCAACTCCAGACCTGCTGAATTGATGAAGAAATAATGAAGGAATAGCCCACAGTTGTCCAGTTACTTTTGGTCCCTTGAAAAAAAGGGGGGCTACATATAAAGAGCTGTGATTCTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU13922 True 203 lncRNA 0.46 1 183180 183382

Neighbor

gene id symbol gene type direction distance location
CI01000001_00089680_00091054 RNF146 coding upstream 92065 89680 ~ 91115 (+)
CI01000001_00205299_00213625 TGM1L3 coding downstream 21917 205299 ~ 213958 (+)
CI01000001_00231916_00237164 NA coding downstream 47773 231155 ~ 237540 (+)
CI01000001_00337674_00339265 NA coding downstream 153899 337281 ~ 339350 (+)
CI01000001_00343451_00343828 NA coding downstream 160069 343451 ~ 344399 (+)
CI01000001_00351249_00352199 NA coding downstream 167169 350551 ~ 353522 (+)
G12522 NA non-coding upstream 18655 163795 ~ 164525 (+)
G12559 NA non-coding upstream 20497 162223 ~ 162683 (+)
G12557 NA non-coding upstream 28272 154664 ~ 154908 (+)
G12540 NA non-coding upstream 118363 63634 ~ 64817 (+)
G12494 NA non-coding upstream 161373 17375 ~ 21807 (+)
G12569 NA non-coding downstream 66 183448 ~ 184567 (+)
G12570 NA non-coding downstream 1520 184902 ~ 185153 (+)
G12579 NA non-coding downstream 19389 202771 ~ 202977 (+)
G12581 NA non-coding downstream 21133 204515 ~ 204731 (+)
G12583 NA non-coding downstream 22290 205672 ~ 205988 (+)
G12614 NA other downstream 125762 309144 ~ 310941 (+)
CI01000001_00483853_00488761 VWA1 other downstream 295004 483853 ~ 488825 (+)
G13051 NA other downstream 860331 1043713 ~ 1045152 (+)
CI01000001_01668334_01670035 CAMK2N1B other downstream 1484638 1667762 ~ 1671167 (+)
CI01000001_03618075_03620436 NA other downstream 3432866 3618075 ~ 3621451 (+)

Expression


Co-expression Network