G15544


Basic Information

Item Value
gene id G15544
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 4460975 ~ 4461433 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU17366
TTCAGAGTCTCTCGAAGTAACATGAATGTGCCCGCTCTGTGAATGATCCATTCTTGTTTTTGTGATATGACATTTGATTTCTTAGCTATATATGCGCGTCACTTATGTAAGAACACGGAAGTTGCGTTTCAAAGTCTGACAGTGTTACAGTGAATAAAATGAAACGCAAATAGTAGCTACCTTCGCATTAGTTATATGTAAGACGTCGTTCTTCTAACCAGCGATAACGACTCTTATTGCAGCAACACTCTTATCTGCTTCTGGAAAACTGTCTGGCAGTGGAGCGTCTTGACCAGTGGCTCACTACCGGCTGACGCTGACAGCAGATCCGTTATATATACTTCTTTTCAGATTAGATATCCCATTATTAGTCACACGCAGCAGCATTCTAGACTTCAAAACCCGCTGAATCAGTATAATCCTTATAATCACATTCCAAATCGGAAGTAGTGATGGGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU17366 True 459 lncRNA 0.41 1 4460975 4461433

Neighbor

gene id symbol gene type direction distance location
CI01000001_04402985_04419845 NA coding downstream 41098 4402780 ~ 4419877 (-)
CI01000001_04395469_04399381 FKBP1B.L, FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A coding downstream 61171 4392314 ~ 4399804 (-)
CI01000001_04378975_04384527 SDCBP2, SDCB1, SDCBP coding downstream 76389 4378885 ~ 4384586 (-)
CI01000001_04343042_04345953 NA coding downstream 114391 4342041 ~ 4346641 (-)
CI01000001_04334653_04338081 NA coding downstream 122206 4334163 ~ 4338769 (-)
CI01000001_04465168_04466295 CDC42.L, CDC42L2, CDC42P6, CDC42 coding upstream 3379 4463257 ~ 4466918 (-)
CI01000001_04468566_04523431 DNMT3BB.1 coding upstream 6776 4468209 ~ 4523431 (-)
CI01000001_04726550_04727511 PDPFB, PPDPFB, PPDPF coding upstream 264971 4725927 ~ 4728210 (-)
CI01000001_04732844_04744038 NA coding upstream 271411 4732844 ~ 4744038 (-)
CI01000001_04746153_04754209 NA coding upstream 284700 4746133 ~ 4754209 (-)
G15546 NA non-coding downstream 2217 4456197 ~ 4458758 (-)
G15539 NA non-coding downstream 10514 4450209 ~ 4450461 (-)
G15625 NA non-coding downstream 11556 4448865 ~ 4449419 (-)
G15609 NA non-coding downstream 107648 4353081 ~ 4353327 (-)
G15608 NA non-coding downstream 109120 4349922 ~ 4351855 (-)
G15537 NA non-coding upstream 224 4461657 ~ 4461912 (-)
G15638 NA non-coding upstream 106311 4567744 ~ 4568009 (-)
G15703 NA non-coding upstream 169333 4630766 ~ 4631671 (-)
G15704 NA non-coding upstream 170936 4632369 ~ 4633693 (-)
CI01000001_02258523_02262621 NA other downstream 2163763 2258442 ~ 2263103 (-)
G14228 NA other downstream 2404497 2055974 ~ 2056478 (-)
G14219 NA other downstream 2466077 1994210 ~ 1994898 (-)
G14104 NA other downstream 2693517 1763669 ~ 1771468 (-)
G15736 NA other upstream 339468 4800901 ~ 4801395 (-)
G16332 NA other upstream 489256 4950689 ~ 4957842 (-)
G16462 NA other upstream 761344 5222777 ~ 5229585 (-)

Expression


Co-expression Network