G16084


Basic Information

Item Value
gene id G16084
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 5877033 ~ 5877272 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU17989
CCCTACAGTATAAAATCCGGGTATCTTTTGTTTTTTGAAACCACACTAATGGGGAAGACTGCTGACTTGGCAATGGTCCAGGAGACAATCATTGACACCCTCCACAAAGAGAGTAAGTCACAGAAGGTCATTACTGAATGGGGTGGCTGTTTACAGAGTGAAATATCAAAGCATATTAAATGCAAAGTTGACTGGAAGGAAGAAATTGGGTAGGCAAAGGTACACAAGCAACAGGGATGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU17989 True 240 lncRNA 0.36 1 5877033 5877272

Neighbor

gene id symbol gene type direction distance location
CI01000001_05861486_05864311 NA coding upstream 12429 5861445 ~ 5864604 (+)
CI01000001_05842665_05846705 KCTD6B, KCTD6, KCTD6A coding upstream 30109 5842665 ~ 5846924 (+)
CI01000001_05838017_05841551 ABHD6B coding upstream 35350 5838017 ~ 5841683 (+)
CI01000001_05814686_05836203 NA coding upstream 39795 5814646 ~ 5837238 (+)
CI01000001_05803416_05809184 SLMAPB coding upstream 67727 5803416 ~ 5809306 (+)
CI01000001_05883364_05897204 NA coding downstream 2303 5879575 ~ 5897214 (+)
CI01000001_05902661_05905496 NA coding downstream 25098 5902370 ~ 5905786 (+)
CI01000001_05933655_05938581 FLNA coding downstream 56383 5933655 ~ 5939241 (+)
CI01000001_05942155_05943721 NA coding downstream 64883 5942155 ~ 5944019 (+)
CI01000001_05960289_05963221 NA coding downstream 81077 5958349 ~ 5963343 (+)
G16080 NA non-coding upstream 5141 5871606 ~ 5871892 (+)
G16071 NA non-coding upstream 91339 5785342 ~ 5785694 (+)
G16060 NA non-coding upstream 118627 5756362 ~ 5758406 (+)
G16090 NA non-coding downstream 8518 5885790 ~ 5886041 (+)
G16112 NA non-coding downstream 130967 6008239 ~ 6009382 (+)
G16131 NA non-coding downstream 179867 6057139 ~ 6057348 (+)
G16134 NA non-coding downstream 191336 6068608 ~ 6068868 (+)
G16141 NA non-coding downstream 205414 6082686 ~ 6083444 (+)
G15995 NA other upstream 162082 5711885 ~ 5714951 (+)
CI01000001_05279884_05287123 NA other upstream 587077 5279837 ~ 5287698 (+)
G15794 NA other upstream 812329 5061218 ~ 5064704 (+)
CI01000001_03618075_03620436 NA other upstream 2255582 3618075 ~ 3621451 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 4206029 1667762 ~ 1671167 (+)
CI01000001_07531945_07539781 NA other downstream 1655300 7531541 ~ 7540586 (+)
G17234 NA other downstream 2154852 8032124 ~ 8032483 (+)
G17353 NA other downstream 3338750 9216022 ~ 9228859 (+)
G17354 NA other downstream 3357191 9234463 ~ 9240677 (+)
CI01000001_09435836_09436037 NA other downstream 3541056 9435836 ~ 9436373 (+)

Expression


Co-expression Network