CI01000004_08518587_08521540 (EIF5A2, EIF5A.L, EIF5A)


Basic Information

Item Value
gene id CI01000004_08518587_08521540
gene name EIF5A2, EIF5A.L, EIF5A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 8518462 ~ 8521661 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000004_08518587_08521540.mRNA
ATATATAAACATAGTATTACTATCTGATACCAGCTGTACTCCTTAATATGTAAATACCGTATTACATGGATGTGGTAATTATTCCGTTTTCCTCTGCGCACAGAATCCTCATCGATTAACCCATCATGGCTGATCTTGATACTGATTTCACCAGTGGAGATGCTGGGGCTTCTCTTACCTTCCCCATGCAGTGCAGTGCTCTGCGTAAGAACGGCTTTGTGGTGCTAAAGGGACGTCCATGCAAGATTGTGGAGATGTCTACTTCCAAGACTGGCAAGCATGGACATGCCAAGGTGCACTTGGTTGGAATTGACATATTTACTGGAAAGAAAAATGAAGATATCTGTCCCTCCACCCACAACATGGATGTTCCAAATATCAAGAGACTGGACTATCAACTGGTTGGCATTACCGATGGCTACCTTTCCCTGCTGAAGGATAATGGAGATCTACGTGAGGACCTCAAGCTGCCTGAGGGGGATCTGGGCAAAGAAATAGAGAGCAAATTTGAATCTGGGGATGAATTTCTGGTCTCTGTGTTGGCTGCCATGGGGGAGGAGTGTCCCATTGCCATCAAGCCCATGAGCTCATAATGAACAGAAGCTGACAGGCTGGTTGAGTGAGGGCCTCTATACCACAAATATTACATTTTAGTTCTAAAAGTCACCAAAGCCACAGCCTTCACAAACCACGTAGAATTGTTTGTGTTAAACA

Function

symbol description
eif5a Predicted to enable translation elongation factor activity. Predicted to be involved in positive regulation of translational elongation. Predicted to act upstream of or within several processes, including mRNA transport; positive regulation of translational termination; and translation. Predicted to be located in endoplasmic reticulum membrane and nucleus. Predicted to be part of nuclear pore. Is expressed in endoderm; intestine; liver; pancreas; and swim bladder. Orthologous to several human genes including EIF5A (eukaryotic translation initiation factor 5A).
eif5a2 Predicted to enable translation elongation factor activity. Predicted to be involved in positive regulation of translational elongation. Predicted to act upstream of or within several processes, including mRNA transport; positive regulation of translational termination; and translational elongation. Predicted to be located in endoplasmic reticulum membrane and nucleus. Predicted to be part of nuclear pore. Orthologous to human EIF5A2 (eukaryotic translation initiation factor 5A2).

GO:

id name namespace
GO:0006452 translational frameshifting biological_process

KEGG:

id description
K03263 EIF5A; translation initiation factor 5A

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000004_08518587_08521540.mRNA True 714 mRNA 0.45 4 8518462 8521661

Neighbor

gene id symbol gene type direction distance location
CI01000004_08507941_08515797 SLC2A2 coding upstream 2154 8507941 ~ 8516308 (+)
CI01000004_08458998_08503889 TNIK, TNIKA coding upstream 14470 8458998 ~ 8503992 (+)
CI01000004_08414451_08436256 NA coding upstream 82199 8414316 ~ 8439933 (+)
CI01000004_08382042_08402126 PLD1A coding upstream 115948 8380472 ~ 8402514 (+)
CI01000004_08302613_08354790 FNDC3BA coding upstream 163667 8302613 ~ 8354795 (+)
CI01000004_08573940_08586930 NA coding downstream 51080 8572741 ~ 8587170 (+)
CI01000004_08618566_08669147 NA coding downstream 96905 8618566 ~ 8669147 (+)
CI01000004_08693419_08703448 PLPPR3A coding downstream 171758 8693419 ~ 8704156 (+)
CI01000004_08730011_08731219 PALM1B coding downstream 208350 8730011 ~ 8732509 (+)
CI01000004_08736175_08742487 PTBP1B, PTBP1, PTBP1A coding downstream 214514 8736175 ~ 8744387 (+)
G28848 NA non-coding upstream 46578 8470745 ~ 8471884 (+)
G28843 NA non-coding upstream 107242 8410726 ~ 8411220 (+)
G28835 NA non-coding upstream 149389 8368861 ~ 8369073 (+)
G28834 NA non-coding upstream 152541 8365695 ~ 8365921 (+)
G28819 NA non-coding upstream 234365 8277202 ~ 8284097 (+)
G28849 NA non-coding downstream 5784 8527445 ~ 8527675 (+)
G28855 NA non-coding downstream 32571 8554232 ~ 8554563 (+)
G28858 NA non-coding downstream 74191 8595852 ~ 8597783 (+)
G28861 NA non-coding downstream 80962 8602623 ~ 8602843 (+)
G28862 NA non-coding downstream 81434 8603095 ~ 8603461 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 862079 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 1944041 6570771 ~ 6572667 (+)
G28302 NA other upstream 2016375 6470028 ~ 6502087 (+)
G28165 NA other upstream 2785461 5732589 ~ 5733001 (+)
G28859 NA other downstream 77574 8599235 ~ 8599603 (+)
CI01000004_08976512_08980033 TTPA other downstream 454777 8976254 ~ 8980984 (+)
G30797 NA other downstream 1975715 10497376 ~ 10497788 (+)
G31710 NA other downstream 3115590 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 3143112 11666900 ~ 11667659 (+)

Expression


Co-expression Network