G26349


Basic Information

Item Value
gene id G26349
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 3655813 ~ 3656027 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU29737
CCACAATAACCTCGGGATAAACAGAGAGACTAATATTAGCGTAGATGCCATTCTTCTTAACATGTAACAAGTACATTGGGTATTATGGGAAGTGTTCTGGTTCCGTTTGACCTAATTTATGCAGCCTAACAATCCTTTAATGGATGTGAATTATAGAAATGTGTTATGTGTATGCCAGGTTAAAGAGATGTGTTTTTGTCTTGATTTAAACTGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU29737 True 215 lncRNA 0.36 1 3655813 3656027

Neighbor

gene id symbol gene type direction distance location
CI01000004_03592655_03592917 NA coding upstream 62896 3592655 ~ 3592917 (+)
CI01000004_03550525_03552621 PTGER4C coding upstream 102390 3550329 ~ 3553423 (+)
CI01000004_03504401_03504700 NA coding upstream 150881 3504278 ~ 3504932 (+)
CI01000004_03496175_03497985 DMBX1, DMBX1A coding upstream 157429 3494746 ~ 3498384 (+)
CI01000004_03432787_03433110 NA coding upstream 222359 3432787 ~ 3433454 (+)
CI01000004_03735876_03736152 NA coding downstream 79727 3735754 ~ 3737017 (+)
CI01000004_03814120_03839793 NA coding downstream 158024 3814051 ~ 3839807 (+)
CI01000004_03878083_03909016 NA coding downstream 221992 3878019 ~ 3909309 (+)
CI01000004_03934726_03935639 NA coding downstream 277658 3933685 ~ 3935870 (+)
CI01000004_04048829_04053849 NA coding downstream 389901 4045928 ~ 4054570 (+)
G26233 NA non-coding upstream 66626 3586835 ~ 3589187 (+)
G26276 NA non-coding upstream 69356 3585785 ~ 3586457 (+)
G26317 NA non-coding upstream 73048 3582544 ~ 3582765 (+)
CI01000004_03426800_03430289 GBG12, GNG12, GNG12.L, GNG12A non-coding upstream 224278 3425462 ~ 3431535 (+)
G26199 NA non-coding upstream 345782 3309796 ~ 3310031 (+)
G26354 NA non-coding downstream 10905 3666932 ~ 3667212 (+)
G26359 NA non-coding downstream 17005 3673032 ~ 3673247 (+)
G26263 NA non-coding downstream 20376 3676403 ~ 3676745 (+)
G26244 NA non-coding downstream 23694 3679721 ~ 3681358 (+)
G26362 NA non-coding downstream 46129 3702156 ~ 3702634 (+)
G26245 NA other upstream 133420 3509017 ~ 3522393 (+)
CI01000004_02745885_02768971 NA other upstream 896875 2745885 ~ 2769135 (+)
G25992 NA other upstream 919045 2736536 ~ 2736768 (+)
G25882 NA other upstream 1082764 2548075 ~ 2573049 (+)
G27805 NA other downstream 1716798 5372825 ~ 5373803 (+)
G28165 NA other downstream 2076562 5732589 ~ 5733001 (+)
G28302 NA other downstream 2814001 6470028 ~ 6502087 (+)
CI01000004_06571261_06572539 SEP15 other downstream 2915193 6570771 ~ 6572667 (+)
CI01000004_07654234_07655677 MRPL34 other downstream 3998745 7654234 ~ 7656383 (+)

Expression


Co-expression Network