G28863


Basic Information

Item Value
gene id G28863
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 8603605 ~ 8603927 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU32641
AGCACTCATATGTGTGTTCATCATTCTCTCAAAGCCTCAGATTTACCGCTGCCATCCTCCACTGCATATTATGCAGCGATTTGTTTCGCTCAGCACACGAGACAACAAACCACTGTGGATCTGCCATGGATAACTAAACAGTTATTCCAGGGTTTATATCATCTTCTGCTTAACATTCACATGTCTGATTATACATCTCTGCCAGCAGGGAGTAGATAAGCAAATTGTCATCATTTTTTATTTGTAAGAAAATGTTTTATTTGCAATTCATTGTTCTCACGTCTTCTGCTGCGACATTGTAATCTGAGAAGATCCTACAAGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU32641 True 323 lncRNA 0.42 1 8603605 8603927

Neighbor

gene id symbol gene type direction distance location
CI01000004_08573940_08586930 NA coding upstream 16435 8572741 ~ 8587170 (+)
CI01000004_08518587_08521540 EIF5A2, EIF5A.L, EIF5A coding upstream 81944 8518462 ~ 8521661 (+)
CI01000004_08507941_08515797 SLC2A2 coding upstream 87297 8507941 ~ 8516308 (+)
CI01000004_08458998_08503889 TNIK, TNIKA coding upstream 99613 8458998 ~ 8503992 (+)
CI01000004_08414451_08436256 NA coding upstream 167342 8414316 ~ 8439933 (+)
CI01000004_08618566_08669147 NA coding downstream 14639 8618566 ~ 8669147 (+)
CI01000004_08693419_08703448 PLPPR3A coding downstream 89492 8693419 ~ 8704156 (+)
CI01000004_08730011_08731219 PALM1B coding downstream 126084 8730011 ~ 8732509 (+)
CI01000004_08736175_08742487 PTBP1B, PTBP1, PTBP1A coding downstream 132248 8736175 ~ 8744387 (+)
CI01000004_08746864_08765484 NA coding downstream 142557 8746484 ~ 8765905 (+)
G28862 NA non-coding upstream 144 8603095 ~ 8603461 (+)
G28861 NA non-coding upstream 762 8602623 ~ 8602843 (+)
G28858 NA non-coding upstream 5822 8595852 ~ 8597783 (+)
G28855 NA non-coding upstream 49042 8554232 ~ 8554563 (+)
G28849 NA non-coding upstream 75930 8527445 ~ 8527675 (+)
G28867 NA non-coding downstream 2387 8606314 ~ 8606585 (+)
G28872 NA non-coding downstream 12294 8616221 ~ 8616535 (+)
G28904 NA non-coding downstream 69294 8673221 ~ 8673463 (+)
G28905 NA non-coding downstream 69831 8673758 ~ 8674201 (+)
G28909 NA non-coding downstream 78780 8682707 ~ 8683005 (+)
G28859 NA other upstream 4002 8599235 ~ 8599603 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 947222 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 2029184 6570771 ~ 6572667 (+)
G28302 NA other upstream 2101518 6470028 ~ 6502087 (+)
CI01000004_08976512_08980033 TTPA other downstream 372511 8976254 ~ 8980984 (+)
G30797 NA other downstream 1893449 10497376 ~ 10497788 (+)
G31710 NA other downstream 3033324 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 3060846 11666900 ~ 11667659 (+)
G31865 NA other downstream 3588203 12192130 ~ 12197418 (+)

Expression


Co-expression Network