G52725


Basic Information

Item Value
gene id G52725
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 3647714 ~ 3647979 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU60056
CATGTTCAAATCAGTCAGTTTTGCTCTGTTCACACTAAACATCCAACACTGTTATCCACTCAAAGGTTTAGCCATACTGCACTGGTCAGCTGAACATGCTCAAAAGTAGGTCATAACCAGTGTTAGATTATGCTGGCAGAGTCCGCATATTGTGCTACTAAGAGATGACAGTAGTATATCATAACATTCAGAATTTTTCCCATGATTTTTTACTAGATTTTAAATGCTTAGTTTCATTATCAAAGCTCTGTATTTTAACACAGGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU60056 True 266 lncRNA 0.37 1 3647714 3647979

Neighbor

gene id symbol gene type direction distance location
CI01000009_03643048_03645741 DCNL2, DCUN1D2, DCUN1D2A coding downstream 554 3642248 ~ 3647160 (-)
CI01000009_03633868_03640910 CDC16 coding downstream 6804 3633704 ~ 3640910 (-)
CI01000009_03622269_03631417 UPF3A coding downstream 16297 3621937 ~ 3631417 (-)
CI01000009_03614390_03616151 P2RY8 coding downstream 31095 3613791 ~ 3616619 (-)
CI01000009_03599584_03602070 ASMTL coding downstream 45644 3599349 ~ 3602070 (-)
CI01000009_03664045_03666052 NA coding upstream 15968 3663947 ~ 3666737 (-)
CI01000009_03668956_03672426 NA coding upstream 20813 3668792 ~ 3672426 (-)
CI01000009_03699312_03715114 APP, APPB, APPA coding upstream 51333 3699312 ~ 3715114 (-)
CI01000009_03770045_03770497 NA coding upstream 121931 3769910 ~ 3770497 (-)
CI01000009_03791699_03858262 NCAM2 coding upstream 142719 3790698 ~ 3859234 (-)
G52670 NA non-coding downstream 193164 3454343 ~ 3454550 (-)
G52639 NA non-coding downstream 240838 3406663 ~ 3406876 (-)
G52623 NA non-coding downstream 261654 3381984 ~ 3386060 (-)
G52606 NA non-coding downstream 345053 3300949 ~ 3302661 (-)
G52501 NA non-coding downstream 356891 3287318 ~ 3290823 (-)
G52735 NA non-coding upstream 82921 3730900 ~ 3731251 (-)
G52736 NA non-coding upstream 83334 3731313 ~ 3731533 (-)
G52739 NA non-coding upstream 87844 3735823 ~ 3736139 (-)
G52743 NA non-coding upstream 95348 3743327 ~ 3743553 (-)
G52770 NA non-coding upstream 399844 4047823 ~ 4048261 (-)
CI01000009_03261739_03262843 NA other downstream 385757 3261038 ~ 3262843 (-)
CI01000009_02885473_02893975 NA other downstream 748307 2883688 ~ 2893975 (-)
G52410 NA other downstream 1085181 2551724 ~ 2562533 (-)
G52098 NA other downstream 2240087 1401932 ~ 1407627 (-)
G52828 NA other upstream 569441 4217420 ~ 4231469 (-)
G53515 NA other upstream 1854416 5502395 ~ 5505248 (-)
G55814 NA other upstream 4777842 8425821 ~ 8428012 (-)
CI01000009_08858198_08860555 NA other upstream 5210173 8856310 ~ 8860563 (-)
G59097 NA other upstream 8640238 12288217 ~ 12289518 (-)

Expression


Co-expression Network