G127386


Basic Information

Item Value
gene id G127386
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035910.1
NCBI id CM008313.1
chromosome length 38842236
location 36067927 ~ 36094480 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU172039
aatgatgagtttctttgatttttccaaattgaaaacctctggaatataatcaagaggaagatggatgatcacaaggcatcaaaccaccaaactgaactgcttgaatttttgcaccaggagtaaagcagcataaagttatccaaaagcagtgtgtaagactggtggaggagaacatgatgccaagatgcatgacaaaaaact

Function

GO: NA

KEGG:

id description
ko04550 Signaling pathways regulating pluripotency of stem cells

RNA

RNA id representative length rna type GC content exon number start site end site
TU172039 True 201 lncRNA 0.38 2 36067927 36094480

Neighbor

gene id symbol gene type direction distance location
jak2 jak2 coding upstream 26961 35981868 ~ 36040966 (+)
LOC103043535 NA coding upstream 87841 35976784 ~ 35980086 (+)
LOC103043841 LOC103043841 coding upstream 92382 35970109 ~ 35975545 (+)
LOC103026124 LOC108436592,LOC106955578,LOC104953222 coding upstream 202500 35851414 ~ 35865427 (+)
nudt2 nudt2,LOC107661859,LOC107739745,LOC107579639 coding upstream 256220 35809505 ~ 35811707 (+)
zer1 zer1,LOC107717741,LOC106570444 coding downstream 111814 36206294 ~ 36223911 (+)
LOC103041373 NA coding downstream 223652 36318132 ~ 36322205 (+)
LOC103041064 stk10,LOC100703168,LOC101487196,LOC102210605 coding downstream 229254 36323734 ~ 36392902 (+)
gfi1b gfi1b,LOC108444114,LOC106563235,LOC108271917 coding downstream 368693 36463173 ~ 36472246 (+)
gpn3 gpn3,LOC102778879 coding downstream 535545 36630025 ~ 36634321 (+)
G127375 NA non-coding upstream 84051 35982698 ~ 35983876 (+)
G127362 NA non-coding upstream 119882 35947390 ~ 35948045 (+)
G127291 NA non-coding upstream 316549 35750262 ~ 35751378 (+)
G127279 NA non-coding upstream 364820 35650119 ~ 35703107 (+)
G127274 NA non-coding upstream 463284 35596326 ~ 35604643 (+)
G127398 NA non-coding downstream 86578 36181058 ~ 36183606 (+)
G127413 NA non-coding downstream 264751 36359231 ~ 36396563 (+)
G127412 NA non-coding downstream 284371 36378851 ~ 36394024 (+)
G127439 NA non-coding downstream 421472 36515952 ~ 36552438 (+)
G127442 NA non-coding downstream 527673 36622153 ~ 36634817 (+)
dtwd2 dtwd2 other upstream 98474 35966334 ~ 35969453 (+)
G127365 NA other upstream 109626 35954858 ~ 35958301 (+)
G127359 NA other upstream 124805 35934919 ~ 35943122 (+)
ubap1 ubap1 other upstream 229873 35828635 ~ 35838054 (+)
glrx glrx,LOC105014469,LOC107661879 other upstream 306815 35755344 ~ 35761112 (+)
G127393 NA other downstream 81313 36175793 ~ 36177113 (+)
G127414 sh3pxd2b,LOC108413712 other downstream 302413 36396893 ~ 36401487 (+)
LOC103040450 atp2a2b,LOC108444117,LOC108278817,LOC103365013 other downstream 558817 36653297 ~ 36709049 (+)
G127456 NA other downstream 774158 36868638 ~ 36880665 (+)
sema4d sema4d,LOC107568542 other downstream 1070220 37164700 ~ 37214615 (+)

Expression


Co-expression Network