G98904


Basic Information

Item Value
gene id G98904
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035907.1
NCBI id CM008310.1
chromosome length 11650534
location 9994644 ~ 10003790 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU133349
aaagagtctaaaatcggagagggtgcgcatttctagcgcagaaaaacgggccaaagagtctaaaatcggagagggtgcgcatttctagcacagaaaaacgggccaaagagtctaaaagcggagagggtgcgcatttctagcgcagaaaaacaggccaaagagtctaaaagcggagagggtgcgcatttctagcgcagaaaaacgggccaaagagtctaaaagttgccgttattaaggagtttaatattaagagacatcatgaaattaaacatcaatttgaaaaatcttagt

Function

NR:

description
PREDICTED: CDGSH iron-sulfur domain-containing protein 1-like, partial

GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0030162 regulation of proteolysis biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:0009611 response to wounding biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0006508 proteolysis biological_process
GO:0050817 coagulation biological_process
GO:0042060 wound healing biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU133349 True 291 lncRNA 0.43 2 9994644 10003790

Neighbor

gene id symbol gene type direction distance location
LOC103025791 LOC103025791 coding downstream 13466 9973281 ~ 9981178 (-)
p3h3 p3h3 coding downstream 224588 9754233 ~ 9770056 (-)
LOC103042898 gnb3a,gnb3,LOC103042898,LOC108432288,LOC107672997,LOC102782474,LOC107549492 coding downstream 250726 9723291 ~ 9743918 (-)
LOC103044428 NA coding downstream 469834 9508056 ~ 9524810 (-)
LOC103022230 LOC107698273 coding downstream 833945 9140699 ~ 9160699 (-)
LOC103025485 NA coding upstream 30957 10034747 ~ 10041021 (-)
LOC103039304 NA coding upstream 67930 10071720 ~ 10092767 (-)
LOC103025185 NA coding upstream 116142 10119932 ~ 10170053 (-)
grik5 grik5,LOC107551699,LOC107717427,LOC107700189,LOC107671209 coding upstream 171614 10175404 ~ 10324815 (-)
LOC103037398 znf574 coding upstream 449277 10453067 ~ 10467258 (-)
G98884 NA non-coding downstream 45484 9858723 ~ 9949160 (-)
G98873 NA non-coding downstream 159281 9834366 ~ 9835363 (-)
G98806 NA non-coding downstream 201646 9790968 ~ 9792998 (-)
G98805 NA non-coding downstream 203899 9772415 ~ 9790745 (-)
G98783 NA non-coding downstream 242933 9751168 ~ 9751711 (-)
G98916 pafah1b3,LOC107755833,LOC108266541,LOC108432331,LOC107671211,LOC107578591,LOC107700190 non-coding upstream 40122 10043912 ~ 10045308 (-)
G98907 NA non-coding upstream 45272 10049062 ~ 10051793 (-)
G98918 NA non-coding upstream 59153 10062943 ~ 10063260 (-)
G98912 NA non-coding upstream 59924 10063714 ~ 10069023 (-)
G98925 NA non-coding upstream 102341 10106131 ~ 10112763 (-)
G98804 NA other downstream 193726 9799623 ~ 9800918 (-)
LOC103043823 tpi1,tpi1b,LOC107700200 other downstream 416591 9560132 ~ 9578053 (-)
LOC103027931 zgc:92606,LOC108432344,LOC107549485,LOC107724707,LOC107672985,LOC107598403 other downstream 456974 9529636 ~ 9537670 (-)
yeats4 yeats4,LOC107555875,LOC107590554,LOC106609801,LOC107717680 other downstream 815276 9162401 ~ 9179368 (-)
LOC103034868 NA other downstream 1079713 8901468 ~ 8914931 (-)
erf erf other upstream 500164 10503954 ~ 10580725 (-)
G99033 NA other upstream 600140 10603930 ~ 10606219 (-)
G99212 LOC108443719,LOC107595576,LOC107657689,LOC107699452,LOC107593646 other upstream 1251807 11255597 ~ 11260752 (-)

Expression


Co-expression Network