CI01000013_02529628_02531898 (GNAO1, GNAO1A, GNAO1.L)


Basic Information

Item Value
gene id CI01000013_02529628_02531898
gene name GNAO1, GNAO1A, GNAO1.L
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 2529557 ~ 2531898 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000013_02529628_02531898.mRNA
AATCGCATGCACGAGTCTCTTATGCTGTTCGATTCCATCTGTAACAACAAATTCTTCATTGACACTTCCATCATTCTCTTCCTCAACAAGAAAGACCTGTTCGCTGAAAAGATCAAGAAATCTCCACTGAGTATCTGTTTCCCTGAATACACAGGTCCAAACACCTACGACGATGCAGCTGCTTACATCCAAGCACAATTTGAAAGCAAGAACCGCTCGCCTAATAAGGAGATCTACTGTCACATGACCTGTGCCACGGATACAGGAAACATCCAGGTGGTGTTCGATGCCGTGACCGACATCATCATCGCCAACAACCTGCGAGGCTGCGGCTTGTACTGAGGCCCGCCCCCTCCCTCTCGAGCCACTTCTTTGGAAATGATTATTATTGAAAATGCAAGTTGGTAAATAAT

Function

symbol description
gnao1a Predicted to enable G protein-coupled receptor binding activity; G-protein beta/gamma-subunit complex binding activity; and GTPase activity. Predicted to be involved in adenylate cyclase-modulating G protein-coupled receptor signaling pathway and dopamine receptor signaling pathway. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be part of heterotrimeric G-protein complex. Is expressed in gill; nervous system; neural rod; and trigeminal placode. Human ortholog(s) of this gene implicated in developmental and epileptic encephalopathy 17 and neurodevelopmental disorder with involuntary movements. Orthologous to human GNAO1 (G protein subunit alpha o1).
gnao1 Predicted to enable G protein-coupled receptor binding activity; G-protein beta/gamma-subunit complex binding activity; and GTPase activity. Predicted to be involved in adenylate cyclase-modulating G protein-coupled receptor signaling pathway and dopamine receptor signaling pathway. Predicted to act upstream of or within G protein-coupled receptor signaling pathway; locomotory behavior; and regulation of heart contraction. Predicted to be located in plasma membrane. Predicted to be part of heterotrimeric G-protein complex. Implicated in developmental and epileptic encephalopathy 17 and neurodevelopmental disorder with involuntary movements.

GO:

id name namespace
GO:0006457 protein folding biological_process

KEGG:

id description
K04534 GNAO, G-ALPHA-O; guanine nucleotide-binding protein G(o) subunit alpha

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000013_02529628_02531898.mRNA True 413 mRNA 0.46 2 2529557 2531898

Neighbor

gene id symbol gene type direction distance location
CI01000013_02515682_02518699 CBFB coding downstream 10321 2515460 ~ 2519236 (-)
CI01000013_02484671_02489919 NA coding downstream 39297 2484671 ~ 2490260 (-)
CI01000013_02483356_02484395 NA coding downstream 45162 2482770 ~ 2484395 (-)
CI01000013_02321895_02371964 MEF2A, MEF2AA coding downstream 157593 2321895 ~ 2371964 (-)
CI01000013_02295361_02314298 MCTP2A coding downstream 214745 2294788 ~ 2314812 (-)
CI01000013_02536846_02547039 GNAO1, GNAO1A coding upstream 4948 2536846 ~ 2547039 (-)
CI01000013_02606100_02629603 GNAO1, GNAO1A coding upstream 74202 2606100 ~ 2629603 (-)
CI01000013_02718442_02730091 BCAR1 coding upstream 186408 2718306 ~ 2731589 (-)
CI01000013_02733870_02751654 NA coding upstream 201808 2733706 ~ 2751654 (-)
CI01000013_02834348_02858912 CFDP1 coding upstream 302356 2834254 ~ 2858912 (-)
G79744 NA non-coding downstream 63674 2465669 ~ 2465883 (-)
G79740 NA non-coding downstream 67313 2461984 ~ 2462244 (-)
G79736 NA non-coding downstream 72895 2456349 ~ 2456662 (-)
G79725 NA non-coding downstream 85790 2443422 ~ 2443767 (-)
CI01000013_02144531_02157776 NA non-coding downstream 375045 2143984 ~ 2158007 (-)
G79672 NA non-coding upstream 54554 2586452 ~ 2602617 (-)
G79752 NA non-coding upstream 99152 2631050 ~ 2631306 (-)
G79755 NA non-coding upstream 100590 2632488 ~ 2632836 (-)
G79756 NA non-coding upstream 101259 2633157 ~ 2633376 (-)
G79757 NA non-coding upstream 101506 2633404 ~ 2633727 (-)
G78296 NA other downstream 2502660 26528 ~ 26897 (-)
G79690 NA other upstream 281349 2813247 ~ 2815392 (-)
G80262 NA other upstream 1033273 3565171 ~ 3567537 (-)
G80271 NA other upstream 1187535 3719433 ~ 3723607 (-)
G80399 NA other upstream 1372169 3904067 ~ 3906240 (-)
G80443 NA other upstream 1533044 4064942 ~ 4066017 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) AMCG00020350 gnao1a,LOC100693875,LOC105926579,LOC108264367,LOC103138895,LOC106939917 coding CM030127.1 CM030127.1 16984587 ~ 16987141 (+)