G79310


Basic Information

Item Value
gene id G79310
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 2468883 ~ 2469113 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU90329
CATCTACATGCCAACAAGTAACAAAGCGTTATAAGTGGACCTCATTACCGGTCAGTCAAATGAATGCAGTTCGTGGTCATTATATAAGGTGGAGGTCTGGTTGACAAATGAGGCTCTGACCCTTTTATTCCCAAAGAGCTGAATACAAGTTCCCGCTCATCTCGTTCTTTCTCTGTATCTCTCTCGGTGTGTGTGGGCGGCTCTCTTCAGTGCAAATCAATACCTCTTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU90329 True 231 lncRNA 0.45 1 2468883 2469113

Neighbor

gene id symbol gene type direction distance location
CI01000013_02411870_02429950 NA coding upstream 38926 2410427 ~ 2429957 (+)
CI01000013_02409027_02409452 NA coding upstream 59276 2407306 ~ 2409607 (+)
CI01000013_02386700_02394730 NA coding upstream 73587 2386348 ~ 2395296 (+)
CI01000013_02081079_02127936 NA coding upstream 340614 2080666 ~ 2128269 (+)
CI01000013_02033469_02034368 NA coding upstream 434145 2033115 ~ 2034738 (+)
CI01000013_02510121_02510417 NA coding downstream 40970 2510083 ~ 2513164 (+)
CI01000013_02528016_02529126 NA coding downstream 58335 2527448 ~ 2529246 (+)
CI01000013_02656037_02664145 HSF4 coding downstream 186924 2656037 ~ 2664398 (+)
CI01000013_02666598_02669821 NUDT21, CPSF5, NUDT21.L coding downstream 197485 2666598 ~ 2669821 (+)
CI01000013_02685665_02686639 NA coding downstream 213354 2682467 ~ 2686835 (+)
G79303 NA non-coding upstream 11282 2457388 ~ 2457601 (+)
G79291 NA non-coding upstream 31029 2437648 ~ 2437854 (+)
G79290 NA non-coding upstream 32040 2436442 ~ 2436843 (+)
G79194 NA non-coding upstream 48776 2419521 ~ 2420107 (+)
G79185 NA non-coding upstream 83695 2371730 ~ 2385188 (+)
G79332 NA non-coding downstream 56993 2526106 ~ 2526930 (+)
G79344 NA non-coding downstream 103588 2572701 ~ 2573523 (+)
G79358 NA non-coding downstream 126825 2595938 ~ 2598371 (+)
G79402 NA non-coding downstream 225599 2694712 ~ 2695125 (+)
G79309 NA other upstream 1712 2466765 ~ 2467171 (+)
G77695 NA other upstream 1515914 946521 ~ 952969 (+)
G77533 NA other upstream 1759334 708833 ~ 709549 (+)
G80062 NA other downstream 1114895 3584008 ~ 3584784 (+)
CI01000013_04051081_04064651 NA other downstream 1595820 4050837 ~ 4065829 (+)
G80845 NA other downstream 2365965 4835078 ~ 4836232 (+)
CI01000013_06050285_06059640 NA other downstream 3587185 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 3609449 6075400 ~ 6081684 (+)

Expression


Co-expression Network