CI01000016_08752386_08753821 (RPL18.L, RPL18.S, RPL18)


Basic Information

Item Value
gene id CI01000016_08752386_08753821
gene name RPL18.L, RPL18.S, RPL18
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 8752386 ~ 8753821 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000016_08752386_08753821.mRNA
GGAGTTGACATCAGACACAACAAGGACCGTAAGGTTCACAGGAAGGAGCCCAAAAGTCAAGATATTTACCTGAGGCTCTTGGTCAAGTTGTACAGATTCCTGTCTCGTCGTTCTGATGCTCCCTTCAACAAGGTTATTCTGAGGAGACTCTTCATGAGCAAGACCAACCGCCCCCCTCTGGCCCTGTCCCGACTGATCCGTAAGATGAAGCTTCCAGGCCGTGACAACCTGACTGCTGTTGTTGTGGGAACTATTACTGATGATGTCAGAATTCAAAACATCCCTAAACTGAAG

Function

symbol description
rpl18 Predicted to enable RNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome and rough endoplasmic reticulum. Predicted to be part of cytosolic large ribosomal subunit. Human ortholog(s) of this gene implicated in Diamond-Blackfan anemia 18. Orthologous to human RPL18 (ribosomal protein L18).

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K02883 RP-L18e, RPL18; large subunit ribosomal protein L18e

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000016_08752386_08753821.mRNA True 294 mRNA 0.48 3 8752386 8753821

Neighbor

gene id symbol gene type direction distance location
CI01000016_08748359_08750572 NA coding upstream 1650 8748359 ~ 8750736 (+)
CI01000016_08696516_08734418 MYH14 coding upstream 17726 8696516 ~ 8734660 (+)
CI01000016_08675783_08684401 KCNJ14 coding upstream 67880 8673411 ~ 8684506 (+)
CI01000016_08628196_08630801 NA coding upstream 121008 8628196 ~ 8631378 (+)
CI01000016_08553934_08565167 DFNA5 coding upstream 187140 8552843 ~ 8565246 (+)
CI01000016_08766170_08768621 LAG3 coding downstream 12349 8766170 ~ 8768778 (+)
CI01000016_08817749_08824067 NA coding downstream 63928 8817749 ~ 8824078 (+)
CI01000016_08916022_08916606 NA coding downstream 161207 8915028 ~ 8916667 (+)
CI01000016_09026732_09050431 NA coding downstream 272911 9026732 ~ 9050838 (+)
CI01000016_09138227_09156795 NA coding downstream 383613 9137434 ~ 9157472 (+)
G98307 NA non-coding upstream 63167 8671758 ~ 8689219 (+)
G98294 NA non-coding upstream 96253 8655762 ~ 8656133 (+)
G98231 NA non-coding upstream 109408 8642761 ~ 8642978 (+)
G98230 NA non-coding upstream 109976 8642188 ~ 8642410 (+)
G98106 NA non-coding upstream 117956 8632923 ~ 8634430 (+)
G98315 NA non-coding downstream 8892 8762713 ~ 8762969 (+)
G98320 NA non-coding downstream 24722 8778543 ~ 8778763 (+)
G98321 NA non-coding downstream 26746 8780567 ~ 8780906 (+)
G98256 NA non-coding downstream 29792 8783613 ~ 8800681 (+)
G98317 NA non-coding downstream 61815 8815636 ~ 8816240 (+)
G97824 NA other upstream 736611 8014363 ~ 8015775 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other upstream 966663 7783987 ~ 7784996 (+)
G96389 NA other upstream 1591096 7160641 ~ 7161290 (+)
CI01000016_05405791_05407797 AICDA other upstream 3344523 5405791 ~ 5407963 (+)
G95792 NA other upstream 3526445 5219880 ~ 5225941 (+)
G98288 NA other downstream 242277 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 1041810 9795950 ~ 9842576 (+)
G99041 NA other downstream 1170597 9924418 ~ 9925654 (+)
G99410 NA other downstream 1480579 10234400 ~ 10236851 (+)
G99456 NA other downstream 1540570 10294391 ~ 10298904 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_009810 si:ch211-120k19.1 coding NC_007127.7 CM002900.2 16968682 ~ 16991808 (+)