G97165



Basic Information


Item Value
gene id G97165
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 5411655 ~ 5411920 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU110556
GAAAACAATGTGATTACCACATTCAAGGTCCAGGAAAGTACTAAAGACATTGTTAAAATAGTCAACGTGACTGCAGTGGTTCAACCTTAATGTTATGAAGCAACGAGAATACTTTTTGTGCGCAAAAACAAAACAAAAATAACGACTTTATTCAACAAATTCTTCTCTACCTTGTCAGACTCATACGCAGTTGATGCAGTGAACGCAGTTCAGCGCTTCCGTGTTTACGTCCGAACGTTTAAATCACGTATTCTATTAAAATAAGA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU110556 True 266 lncRNA 0.36 1 5411655 5411920

Neighbor


gene id symbol gene type direction distance location
CI01000016_05374626_05378364 NA coding downstream 32982 5373845 ~ 5386465 (-)
CI01000016_05325805_05330265 COX6B2 coding downstream 78781 5325519 ~ 5332874 (-)
CI01000016_05313099_05322439 SLC2A3B coding downstream 88708 5312803 ~ 5322947 (-)
CI01000016_05249001_05286683 EPHB6 coding downstream 124972 5247560 ~ 5286683 (-)
CI01000016_05233964_05243756 NA coding downstream 167287 5233656 ~ 5244368 (-)
CI01000016_05412782_05415867 NA coding upstream 328 5412248 ~ 5415906 (-)
CI01000016_05426889_05429942 NA coding upstream 13856 5425776 ~ 5429942 (-)
CI01000016_05461674_05464777 FOXJ2 coding upstream 49754 5461674 ~ 5464777 (-)
CI01000016_05468882_05473383 ISOC2 coding upstream 56843 5468763 ~ 5473383 (-)
CI01000016_05508930_05523828 CACNG8B coding upstream 96167 5508087 ~ 5523828 (-)
G97160 NA non-coding downstream 9286 5402143 ~ 5402369 (-)
G97148 NA non-coding downstream 69855 5341039 ~ 5341800 (-)
G97012 NA non-coding downstream 206842 5192792 ~ 5204813 (-)
G97139 NA non-coding downstream 220227 5191026 ~ 5191428 (-)
G97180 NA non-coding upstream 141375 5553295 ~ 5553986 (-)
G97203 NA non-coding upstream 153277 5565197 ~ 5566153 (-)
G97215 NA non-coding upstream 154373 5566293 ~ 5573569 (-)
G97252 NA non-coding upstream 365484 5777404 ~ 5777668 (-)
G97255 NA non-coding upstream 422650 5834570 ~ 5834911 (-)
CI01000016_04921091_04922518 NA other downstream 488251 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 1480604 3920055 ~ 3931162 (-)
CI01000016_03647744_03675574 NA other downstream 1746342 3647653 ~ 3675585 (-)
G95070 NA other downstream 2426014 2985260 ~ 2985641 (-)
G97341 NA other upstream 747066 6158986 ~ 6159721 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other upstream 3476913 8888833 ~ 8894737 (-)
CI01000016_08926089_08945071 NA other upstream 3524869 8925960 ~ 8945229 (-)
G98679 NA other upstream 3823076 9234996 ~ 9239929 (-)

Expression



Co-expression Network