G123096



Basic Information


Item Value
gene id G123096
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000024
NCBI id null
chromosome length 8644187
location 2033359 ~ 2033602 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU139764
GGAAAAGATTAAAAATATGACTGTCAGTGACCACTCACACTGAGATGAATGGCAATGAATAACTATCTTCAAGTACTATAGACCTCATTGGTGGTAATAAGGATCTTTTTTTGTGTAAAGTATCTTTGAAACAATATAAATAATAATAAAAAAAATTATAATAAAACTTGACGTTGAGTTGTTAATGAGAGATGTAATAGTAGATGTAGTTTCTAATTCCAGTCTACATTCACTTCAATCCCAT

Function


NR:

description
PREDICTED: basic leucine zipper and W2 domain-containing protein 1-A-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU139764 True 244 lncRNA 0.29 1 2033359 2033602

Neighbor


gene id symbol gene type direction distance location
CI01000024_01955762_01966845 FAM117BA coding downstream 66514 1953804 ~ 1966845 (-)
CI01000024_01922262_01923329 CXCR4A coding downstream 110030 1921891 ~ 1923329 (-)
CI01000024_01882305_01892725 MCM6 coding downstream 139443 1881911 ~ 1893916 (-)
CI01000024_01854695_01861662 PNKD coding downstream 171017 1854365 ~ 1862458 (-)
CI01000024_01847790_01854114 CATIP coding downstream 179245 1847780 ~ 1854114 (-)
CI01000024_02131229_02148749 STK24, STK24B coding upstream 97549 2131151 ~ 2148820 (-)
CI01000024_02170481_02175158 NR4A2, NR4A2A, NR4A2B coding upstream 136141 2169743 ~ 2175158 (-)
CI01000024_02249593_02250941 NA coding upstream 215991 2249593 ~ 2251094 (-)
CI01000024_02402657_02417463 WDSUB1 coding upstream 368811 2402413 ~ 2418061 (-)
CI01000024_02421600_02456292 BAZ2B coding upstream 387998 2421600 ~ 2456292 (-)
G123077 NA non-coding downstream 7584 2025387 ~ 2025775 (-)
G123076 NA non-coding downstream 8629 2024396 ~ 2024730 (-)
G123075 NA non-coding downstream 11187 2021698 ~ 2022172 (-)
G123073 NA non-coding downstream 15763 2017375 ~ 2017596 (-)
G123072 NA non-coding downstream 20464 2012651 ~ 2012895 (-)
G123112 NA non-coding upstream 47052 2080654 ~ 2086639 (-)
G123113 NA non-coding upstream 49435 2083037 ~ 2083511 (-)
G123120 NA non-coding upstream 57882 2091484 ~ 2093216 (-)
G123152 NA non-coding upstream 178352 2211954 ~ 2212419 (-)
G123157 NA non-coding upstream 186463 2220065 ~ 2220355 (-)
CI01000024_00825386_00837898 NA other downstream 1206508 824968 ~ 838550 (-)
G123233 NA other upstream 513858 2547460 ~ 2555036 (-)
CI01000024_03938368_03941795 NA other upstream 1902440 3938315 ~ 3941924 (-)
G125457 NA other upstream 5323635 7357237 ~ 7358104 (-)
G125798 NA other upstream 5942065 7975667 ~ 7976047 (-)

Expression



Co-expression Network