G123159



Basic Information


Item Value
gene id G123159
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000024
NCBI id null
chromosome length 8644187
location 2220768 ~ 2221073 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU139832
TACATAAATTTATCCACTAACCATTCAGAAACGTCCAGTGTCATTCTAAAAGCTGTAACTTCTTCCTGATGGGGCGTTCACACCAGACGCGACTTGCGCGAATAAATCGTAGTTGGATGCTTGAACATTTTGAGTTTACTTGCTTCATTCGCGCGTGAAATTCACTTCACAACAGACGCGAATTCGCATCATGAGAGGGGCTTCTGCCAGGCGGCTCGAGTCTCGTTTCTGCACACTTCCTCTAAATAAACACATCAACTTGTTAGCGGGAAAGTAGTTGTAAAATACGGCGAATAAGCTCAATTT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU139832 True 306 lncRNA 0.43 1 2220768 2221073

Neighbor


gene id symbol gene type direction distance location
CI01000024_02170481_02175158 NR4A2, NR4A2A, NR4A2B coding downstream 45610 2169743 ~ 2175158 (-)
CI01000024_02131229_02148749 STK24, STK24B coding downstream 71948 2131151 ~ 2148820 (-)
CI01000024_01955762_01966845 FAM117BA coding downstream 253923 1953804 ~ 1966845 (-)
CI01000024_01922262_01923329 CXCR4A coding downstream 297439 1921891 ~ 1923329 (-)
CI01000024_01882305_01892725 MCM6 coding downstream 326852 1881911 ~ 1893916 (-)
CI01000024_02249593_02250941 NA coding upstream 28520 2249593 ~ 2251094 (-)
CI01000024_02402657_02417463 WDSUB1 coding upstream 181340 2402413 ~ 2418061 (-)
CI01000024_02421600_02456292 BAZ2B coding upstream 200527 2421600 ~ 2456292 (-)
CI01000024_02484606_02498687 NA coding upstream 263136 2475874 ~ 2503657 (-)
CI01000024_02555602_02562403 ZSWIM2 coding upstream 334210 2555283 ~ 2562932 (-)
G123158 NA non-coding downstream 104 2220370 ~ 2220664 (-)
G123157 NA non-coding downstream 413 2220065 ~ 2220355 (-)
G123152 NA non-coding downstream 8349 2211954 ~ 2212419 (-)
G123120 NA non-coding downstream 127552 2091484 ~ 2093216 (-)
G123112 NA non-coding downstream 134129 2080654 ~ 2086639 (-)
G123163 NA non-coding upstream 40730 2261803 ~ 2262005 (-)
G123165 NA non-coding upstream 41720 2262793 ~ 2263711 (-)
G123169 NA non-coding upstream 45216 2266289 ~ 2266975 (-)
G123223 NA non-coding upstream 302615 2523688 ~ 2523961 (-)
CI01000024_00825386_00837898 NA other downstream 1393917 824968 ~ 838550 (-)
G123233 NA other upstream 326387 2547460 ~ 2555036 (-)
CI01000024_03938368_03941795 NA other upstream 1714969 3938315 ~ 3941924 (-)
G125457 NA other upstream 5136164 7357237 ~ 7358104 (-)
G125798 NA other upstream 5754594 7975667 ~ 7976047 (-)

Expression



Co-expression Network