G123486



Basic Information


Item Value
gene id G123486
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000024
NCBI id null
chromosome length 8644187
location 3088476 ~ 3088691 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU140219
GTTTCTTTTAAAATTAATGCATTACAATATAGCATTACTCCCTAAAAAGTAACTAATTGTGTTAGTTACTTTTTATGAAAAGTAATGCGTTACATTACTTTTACAGAGATGGTCCTCACTGCAGAACACAAGATCCAGGGGGTGGGGTCGGATCTATATCCAACTCCTCCCACTTTACATATCCCTTAAAGGGTTAGTTCACCCAAAAATGAAAAT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU140219 True 216 lncRNA 0.35 1 3088476 3088691

Neighbor


gene id symbol gene type direction distance location
CI01000024_03060967_03068650 MTX2 coding downstream 18770 3060812 ~ 3069706 (-)
CI01000024_03048421_03049271 NA coding downstream 38947 3048164 ~ 3049529 (-)
CI01000024_02939122_02964449 ABCC6A coding downstream 124027 2938383 ~ 2964449 (-)
CI01000024_02849288_02866286 NA coding downstream 222072 2849100 ~ 2866404 (-)
CI01000024_02829108_02838763 ATG9A coding downstream 249280 2828646 ~ 2839196 (-)
CI01000024_03208565_03262749 KCNH7 coding upstream 119874 3208565 ~ 3262749 (-)
CI01000024_03284853_03286057 NA coding upstream 195519 3284210 ~ 3286057 (-)
CI01000024_03311028_03319956 NA coding upstream 222306 3310997 ~ 3319956 (-)
CI01000024_03449111_03472001 ATP7B coding upstream 360114 3448805 ~ 3472001 (-)
CI01000024_03473803_03480757 HTR2AB coding upstream 384899 3473590 ~ 3480757 (-)
G123485 NA non-coding downstream 77 3088195 ~ 3088399 (-)
G123385 NA non-coding downstream 33250 3054359 ~ 3055226 (-)
G123364 NA non-coding downstream 43916 3042806 ~ 3044560 (-)
G123467 NA non-coding downstream 48824 3039433 ~ 3039652 (-)
G123512 NA non-coding upstream 42689 3131380 ~ 3132504 (-)
G123401 NA non-coding upstream 52886 3141577 ~ 3141904 (-)
G123390 NA non-coding upstream 53385 3142076 ~ 3143061 (-)
G123408 NA non-coding upstream 55153 3143844 ~ 3144683 (-)
G123369 NA non-coding upstream 61867 3150558 ~ 3154638 (-)
G123233 NA other downstream 533440 2547460 ~ 2555036 (-)
CI01000024_00825386_00837898 NA other downstream 2261625 824968 ~ 838550 (-)
CI01000024_03938368_03941795 NA other upstream 847351 3938315 ~ 3941924 (-)
G125457 NA other upstream 4268546 7357237 ~ 7358104 (-)
G125798 NA other upstream 4886976 7975667 ~ 7976047 (-)

Expression



Co-expression Network