G126172


Basic Information

Item Value
gene id G126172
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000024
NCBI id null
chromosome length 8644187
location 8405522 ~ 8405988 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU143282
TTACGGTTTCAACACCGTTTTTCCATTTTACAGCTTTCTACAATATAGAAAAATTAAAACAATACATAAACAATACATAATTAACACATCTCTAGTATATGTAGTATATAATGCAAACAGACATGTCAAACTATTTTTCACTAGATGGAGAGAAAATAAATAAAGAAGAAATAGATTATGGTGCATCATTTGCTATTTATTAAAACAGGCAAAAAATAGGCATTGACAAATTGGCTGAAACTGACCCAAACTGATTATCAGCATAAATACAAACAATAAGTTAAAGGGTTAGTTCACCCCAAAATTAAAATTCTGTCATTAAGTACTCACCCTCATGTCGTTCCAAACCCGTAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU143282 True 355 lncRNA 0.30 2 8405522 8405988

Neighbor

gene id symbol gene type direction distance location
CI01000024_08292984_08380058 PBX1.S, PBX1A, PBX1B, PBX1 coding downstream 25464 8292984 ~ 8380058 (-)
CI01000024_08260814_08264845 SZT2 coding downstream 140677 8260814 ~ 8264845 (-)
CI01000024_08161023_08259943 SZT2 coding downstream 145579 8160290 ~ 8259943 (-)
CI01000024_07858315_07901816 NA coding downstream 503584 7858157 ~ 7901938 (-)
CI01000024_07847824_07855700 NA coding downstream 549181 7847573 ~ 7856341 (-)
CI01000024_08450580_08455758 NA coding upstream 44574 8450562 ~ 8457764 (-)
CI01000024_08460577_08479254 NA coding upstream 54481 8460469 ~ 8479690 (-)
CI01000024_08500620_08512420 ACV1B, ACVR1BA, ACVR1BB, ACVR1B coding upstream 93834 8499822 ~ 8512420 (-)
CI01000024_08604727_08620689 TGM2B coding upstream 197799 8603787 ~ 8620724 (-)
CI01000024_08632171_08642748 QUO coding upstream 225944 8631932 ~ 8642748 (-)
G126163 NA non-coding downstream 13945 8391374 ~ 8391577 (-)
G126097 NA non-coding downstream 37730 8352657 ~ 8367792 (-)
G126096 NA non-coding downstream 53213 8338150 ~ 8352309 (-)
G126133 NA non-coding downstream 267074 8138038 ~ 8138448 (-)
G126110 NA non-coding downstream 324021 8081260 ~ 8081501 (-)
G126179 NA non-coding upstream 14175 8420163 ~ 8420527 (-)
G126187 NA non-coding upstream 27491 8433479 ~ 8433696 (-)
G126210 NA non-coding upstream 106722 8512710 ~ 8607995 (-)
G126233 NA non-coding upstream 179068 8585056 ~ 8599810 (-)
G125798 NA other downstream 429475 7975667 ~ 7976047 (-)
G125457 NA other downstream 1047418 7357237 ~ 7358104 (-)
CI01000024_03938368_03941795 NA other downstream 4463598 3938315 ~ 3941924 (-)
G123233 NA other downstream 5850486 2547460 ~ 2555036 (-)
CI01000024_00825386_00837898 NA other downstream 7578671 824968 ~ 838550 (-)

Expression


Co-expression Network