G133564


Basic Information

Item Value
gene id G133564
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 11602202 ~ 11602886 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU151858
TGTTTCTCTTGCTTGGCTTCCTCCTCCTCTTGTTTCTCAACTGATGAATCTTAAGAAGGAATCCCATTGCTATTCTGTATTAAAAGAAAATAGCCTACAGTACACCCAGAAATTTTCTCATGGTTTAGGCTATTCATCTTTTCGCTTCCGACCAACTGTCACCAGCGCCTGCATGAGAGTCGACTTTGCGTTCGACGAAGCATGTTGTAATGAGCAACGTGAAGCTTTCATGACGTTCT

Function

NR:

description
PREDICTED: craniofacial development protein 2-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU151858 True 239 lncRNA 0.43 2 11602202 11602886

Neighbor

gene id symbol gene type direction distance location
CI01000026_11483300_11485455 TADA2B coding upstream 116122 11483300 ~ 11486080 (+)
CI01000026_11456632_11473446 TBC1D14 coding upstream 128549 11456632 ~ 11473653 (+)
CI01000026_11436071_11446054 KIAA0232 coding upstream 155880 11435501 ~ 11446322 (+)
CI01000026_11403059_11415298 PTPN5 coding upstream 186690 11403059 ~ 11415512 (+)
CI01000026_11298219_11305000 NA coding upstream 297189 11298219 ~ 11305013 (+)
CI01000026_11698637_11702653 MAF1.L, MAF1 coding downstream 95751 11698637 ~ 11703649 (+)
CI01000026_11705009_11707949 NA coding downstream 102123 11705009 ~ 11708076 (+)
CI01000026_11756587_11788914 ESYT2B coding downstream 153701 11756587 ~ 11789072 (+)
CI01000026_11792044_11807684 NCAPG2 coding downstream 189158 11792044 ~ 11808274 (+)
CI01000026_11809092_11810238 NA coding downstream 205576 11808462 ~ 11810411 (+)
G133542 NA non-coding upstream 124658 11476117 ~ 11477544 (+)
G133536 NA non-coding upstream 206958 11395044 ~ 11395244 (+)
G133512 NA non-coding upstream 232903 11368840 ~ 11369299 (+)
G133533 NA non-coding upstream 239975 11361816 ~ 11362227 (+)
G133528 NA non-coding upstream 247751 11354162 ~ 11354451 (+)
G133572 NA non-coding downstream 55644 11658530 ~ 11659089 (+)
G133594 NA non-coding downstream 128925 11731811 ~ 11732814 (+)
G133596 NA non-coding downstream 130859 11733745 ~ 11734005 (+)
G133608 NA non-coding downstream 148279 11751165 ~ 11752175 (+)
G134141 NA non-coding downstream 258682 11861568 ~ 11891602 (+)
CI01000026_11241496_11246081 NA other upstream 347129 11241496 ~ 11246204 (+)
CI01000026_11075931_11078249 MDK, MDKA other upstream 523122 11075784 ~ 11079080 (+)
G133192 NA other upstream 1440241 10159819 ~ 10161961 (+)
G132667 NA other upstream 2033042 9568739 ~ 9569160 (+)

Expression


Co-expression Network