G152023


Basic Information

Item Value
gene id G152023
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 1683978 ~ 1684291 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU172668
TTCCAGAGGAAGAGTGACCTCTGACCCGATGTATGACGCAGGATGTAGTAGTAGCGTAAGCTTAGGTGAGAGTAGACGCCTCTCTTGCGGTTCAAGCAAATAGGGCTGGGCAACAAACTCAAGCTACTCTTCTTTTATATTGAAATCCTCCAACATTTCTGTTTACGAATTCTCATTTTAGACTTCTAATTCATGACTGGTGTTTTGTTTTGCTTCATCCTCTGCTCTTCCACATTCGTCAATACGTCGAGTCAAAGTTCACTCTTCTGCCGGAACTAGACTCACGTACGGCCGTTGCCGGAAGCCAGTTATTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU172668 True 314 lncRNA 0.45 1 1683978 1684291

Neighbor

gene id symbol gene type direction distance location
CI01000029_01662550_01681291 NA coding upstream 1888 1662550 ~ 1682090 (+)
CI01000029_01653157_01657944 NA coding upstream 25973 1652840 ~ 1658005 (+)
CI01000029_01616562_01644867 ADCK3, COQ8A coding upstream 39098 1616435 ~ 1644880 (+)
CI01000029_01542500_01557216 C1ORF95, STUM coding upstream 125265 1542150 ~ 1558713 (+)
CI01000029_01533005_01534392 NA coding upstream 149422 1532475 ~ 1534556 (+)
CI01000029_01699880_01719696 UCKL1.L, UCKL1 coding downstream 15375 1699666 ~ 1721489 (+)
CI01000029_01751220_01751657 NA coding downstream 66680 1750971 ~ 1752636 (+)
CI01000029_01815422_01845569 IFT172 coding downstream 131131 1815422 ~ 1845912 (+)
CI01000029_01851039_01859542 NA coding downstream 166748 1851039 ~ 1859988 (+)
CI01000029_01868364_01875110 NA coding downstream 183869 1868160 ~ 1876032 (+)
G152025 NA non-coding upstream 23167 1660547 ~ 1660811 (+)
G152021 NA non-coding upstream 24311 1658994 ~ 1659667 (+)
G152018 NA non-coding upstream 25120 1658608 ~ 1658858 (+)
CI01000029_01526863_01527414 NA non-coding upstream 107538 1526754 ~ 1527899 (+)
G152034 NA non-coding upstream 158778 1524996 ~ 1525200 (+)
G152071 NA non-coding downstream 6894 1691185 ~ 1691392 (+)
G152072 NA non-coding downstream 7794 1692085 ~ 1692595 (+)
G152075 NA non-coding downstream 11359 1695650 ~ 1695901 (+)
G152099 NA non-coding downstream 14461 1698752 ~ 1699040 (+)
G152080 NA non-coding downstream 112804 1797095 ~ 1801517 (+)
G151495 NA other upstream 1312056 366541 ~ 371922 (+)
G151415 NA other upstream 1458733 170521 ~ 225245 (+)
G152451 NA other downstream 1077303 2761594 ~ 2762939 (+)
G153475 NA other downstream 1860834 3545125 ~ 3562004 (+)
G153790 NA other downstream 3049298 4733589 ~ 4740107 (+)
G154587 NA other downstream 3586729 5271020 ~ 5271535 (+)
CI01000029_05461497_05468985 BATF other downstream 3772950 5461497 ~ 5470346 (+)

Expression


Co-expression Network