G155758


Basic Information

Item Value
gene id G155758
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 8381585 ~ 8381784 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU176848
CAAGGTTGCGCATTCTGACTCAGGTGCTAGACTCAAACTCCTGGTGTGTAAGCCACAAATTTCATTTATGAAGGGAATGTGTCCAGATAAACTCAAAACACTTGCAGTCTGTATAACTCATAAATGCATCTTCATTCTTGAGTCTCTCCAACAGTGTTTAGCTTTAGCCATGTTAGCAAACATTCACAAAATGCATGCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU176848 True 200 lncRNA 0.40 1 8381585 8381784

Neighbor

gene id symbol gene type direction distance location
CI01000029_08367350_08368348 GPR6 coding upstream 13071 8366344 ~ 8368514 (+)
CI01000029_08346604_08357224 NA coding upstream 23952 8346401 ~ 8357633 (+)
CI01000029_08318488_08338631 NA coding upstream 42226 8318488 ~ 8339359 (+)
CI01000029_08288440_08301175 NA coding upstream 80228 8288440 ~ 8301357 (+)
CI01000029_08198433_08203489 NA coding upstream 178047 8198365 ~ 8203538 (+)
CI01000029_08425310_08441838 NA coding downstream 42013 8423797 ~ 8441847 (+)
CI01000029_08443106_08447917 CDC40 coding downstream 61174 8442958 ~ 8447917 (+)
CI01000029_08484998_08502958 NA coding downstream 103168 8484952 ~ 8503169 (+)
CI01000029_08506379_08516187 NA coding downstream 124595 8506379 ~ 8516305 (+)
CI01000029_08533907_08555317 PAK6 coding downstream 152123 8533907 ~ 8555969 (+)
G155757 NA non-coding upstream 3295 8378071 ~ 8378290 (+)
G155753 NA non-coding upstream 7256 8374034 ~ 8374329 (+)
G155720 NA non-coding upstream 132872 8248489 ~ 8248713 (+)
G155725 NA non-coding upstream 136095 8244999 ~ 8245490 (+)
G155723 NA non-coding upstream 138780 8242311 ~ 8242805 (+)
G155769 NA non-coding downstream 1084 8382868 ~ 8384341 (+)
G155809 NA non-coding downstream 60356 8442140 ~ 8442351 (+)
G155845 NA non-coding downstream 184523 8566307 ~ 8567447 (+)
G155848 NA non-coding downstream 185831 8567615 ~ 8567913 (+)
G155851 NA non-coding downstream 207602 8589386 ~ 8593261 (+)
G155627 NA other upstream 449408 7931480 ~ 7932177 (+)
G155522 NA other upstream 743751 7634833 ~ 7637834 (+)
CI01000029_06906861_06907157 NA other upstream 1474153 6905834 ~ 6908633 (+)
G155083 NA other upstream 1891291 6431535 ~ 6490294 (+)
G155079 NA other upstream 2093187 6282685 ~ 6288398 (+)
G156007 NA other downstream 583034 8964818 ~ 9064541 (+)

Expression


Co-expression Network