G168536


Basic Information

Item Value
gene id G168536
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000033
NCBI id null
chromosome length 1934898
location 1404992 ~ 1405205 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU191434
GAACAACTCAGCTGATGAGGAATAAAAAGTCTTGGTTCTATACACCACACTGTCAATATCACAAATGAATCCTCCTATTTTACTTACGTACATAGGTAAGTGCTATGTGAAAGTGGATAAAGACCTTGGCTTGCTATGTCAGCCAGTAATGGATTTACTCTGTTAGGGGATGATGCTTCAGATGTCTTATTAATCTCTATTGGTTTTAGCATCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU191434 True 214 lncRNA 0.37 1 1404992 1405205

Neighbor

gene id symbol gene type direction distance location
CI01000033_01375935_01378229 NA coding upstream 25804 1375444 ~ 1379188 (+)
CI01000033_01351073_01357901 CRB3A, CRB3 coding upstream 46942 1350535 ~ 1361048 (+)
CI01000033_01281864_01292221 NA coding upstream 112766 1281864 ~ 1292226 (+)
CI01000033_01208922_01226195 HS3ST3A1, HS3ST3B1B, HS3ST3B1, HS3ST3B1A coding upstream 178746 1208631 ~ 1226246 (+)
CI01000033_01178655_01186085 NA coding upstream 218846 1178393 ~ 1186146 (+)
CI01000033_01620320_01661230 TTYH2L coding downstream 212595 1617800 ~ 1661323 (+)
CI01000033_01677995_01745060 NA coding downstream 272141 1677346 ~ 1745398 (+)
CI01000033_01765591_01779307 NA coding downstream 359462 1764667 ~ 1779344 (+)
CI01000033_01902490_01903373 NA coding downstream 497285 1902490 ~ 1903407 (+)
CI01000033_01928170_01932495 NA coding downstream 522921 1928126 ~ 1932573 (+)
G168532 NA non-coding upstream 3265 1401501 ~ 1401727 (+)
G168530 NA non-coding upstream 5405 1399247 ~ 1399587 (+)
G168500 NA non-coding upstream 96884 1307776 ~ 1308108 (+)
G168482 NA non-coding upstream 169194 1235579 ~ 1235798 (+)
G168539 NA non-coding downstream 1355 1406560 ~ 1406771 (+)
G168543 NA non-coding downstream 3523 1408728 ~ 1408948 (+)
G168561 NA non-coding downstream 44067 1449272 ~ 1449500 (+)
G168562 NA non-coding downstream 46583 1451788 ~ 1452032 (+)
G168563 NA non-coding downstream 49525 1454730 ~ 1454948 (+)

Expression


Co-expression Network