G195074



Basic Information


Item Value
gene id G195074
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 44013 ~ 44252 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU221572
GACCTTCTGGTTGACTTGTCGCTGTCAGATCCAATGAGTGTGTGTCACGGAGGGAATGAGTCGTTGCTGCTACTTTTGAGAGAGTGAATTTGTTAATAACAAAGCCTAGATAAACTGCACATAATTGCTTTGGATAAGACATGGTAAGACACAAGGAAAATAAGATTATGTCTATAATTAGTAGTATTTGCTAAGTAAAGCATCGCTGTTATTATTGAAAATACTTCGAGTAAGTGATTT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU221572 True 240 lncRNA 0.36 1 44013 44252

Neighbor


gene id symbol gene type direction distance location
CI01000046_00035472_00036260 NA coding downstream 7329 34016 ~ 36684 (-)
CI01000046_00055148_00059869 FNTA coding upstream 10563 54815 ~ 59869 (-)
CI01000046_00063416_00065082 NA coding upstream 18901 63153 ~ 65082 (-)
CI01000046_00085822_00091135 AURKB coding upstream 40932 85184 ~ 91135 (-)
CI01000046_00224464_00306703 FAT4 coding upstream 180193 224445 ~ 306703 (-)
CI01000046_00332581_00354353 ANKRD50 coding upstream 288329 332581 ~ 354353 (-)
G195073 NA non-coding downstream 473 43327 ~ 43540 (-)
G195071 NA non-coding downstream 1410 42369 ~ 42603 (-)
G195070 NA non-coding downstream 4682 39050 ~ 39331 (-)
G195069 NA non-coding downstream 19166 24611 ~ 24847 (-)
G195065 NA non-coding downstream 32284 11399 ~ 11729 (-)
G195170 NA non-coding upstream 265376 309628 ~ 309850 (-)
G195172 NA non-coding upstream 267591 311843 ~ 312123 (-)
G195176 NA non-coding upstream 279597 323849 ~ 324062 (-)
G195189 NA non-coding upstream 332669 376921 ~ 377161 (-)
G195194 NA non-coding upstream 343875 388127 ~ 388544 (-)
G195097 NA other upstream 363171 407423 ~ 426326 (-)
G195098 NA other upstream 626484 670736 ~ 676128 (-)
CI01000046_00777923_00780186 RPC11, POLR3K, POLR3K.S other upstream 733481 774434 ~ 780293 (-)
G196463 NA other upstream 2124014 2168266 ~ 2168644 (-)

Expression



Co-expression Network