G195455


Basic Information

Item Value
gene id G195455
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 1308264 ~ 1308561 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU222008
ACATATCAAATGTTGAAAGTGAGACATTTTGAAATGTCATGCCAAATATTGGCTCATTTTGGATTTCATGAGAGCTACACATTCCAAAAAAGTTGGGACAGGTAGCAATAAGAGGCCGGAAAAGTTAAATGTACATATAAGGAACAGCTGGAGGACCAATTTGCAACTTATTAGGTCAATTGGCAACATGATTGGGTATAAAAAGAGCCTCTCAGAGTGGCAGTGTCTCTCAGAAGTCAAGATGGGCAGAGGGTCACCAATTCCCCCAATGCTGCGGCGAAAAATAGTGGAGAAATAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU222008 True 298 lncRNA 0.41 1 1308264 1308561

Neighbor

gene id symbol gene type direction distance location
CI01000046_01236373_01241067 UBE2I coding downstream 67197 1235992 ~ 1241067 (-)
CI01000046_01167146_01194022 BAIAP3 coding downstream 114242 1167028 ~ 1194022 (-)
CI01000046_01098117_01099160 GPR146 coding downstream 209104 1097258 ~ 1099160 (-)
CI01000046_01074910_01076076 GPER1 coding downstream 231840 1074798 ~ 1076424 (-)
CI01000046_01047300_01066367 UNKL, UNKL.S coding downstream 241897 1047209 ~ 1066367 (-)
CI01000046_01421301_01451701 HS3ST2 coding upstream 111951 1420512 ~ 1451931 (-)
CI01000046_01814833_01858924 NA coding upstream 506243 1814804 ~ 1859010 (-)
CI01000046_01926303_01931836 NSMCE1 coding upstream 617563 1926124 ~ 1932117 (-)
CI01000046_01970499_01979300 NA coding upstream 661430 1969991 ~ 1979300 (-)
CI01000046_02031809_02034289 NA coding upstream 722898 2031459 ~ 2034289 (-)
G195408 NA non-coding downstream 5103 1289822 ~ 1303161 (-)
G195445 NA non-coding downstream 24936 1277508 ~ 1283328 (-)
G195435 NA non-coding downstream 56100 1250963 ~ 1252164 (-)
G195410 NA non-coding downstream 73626 1229564 ~ 1234638 (-)
G195431 NA non-coding downstream 146678 1161299 ~ 1161586 (-)
G195563 NA non-coding upstream 87651 1396212 ~ 1396564 (-)
G195798 NA non-coding upstream 226651 1535212 ~ 1535422 (-)
G195852 NA non-coding upstream 335600 1644161 ~ 1719791 (-)
G195856 NA non-coding upstream 345399 1653960 ~ 1673720 (-)
G196405 NA non-coding upstream 603617 1912178 ~ 1912448 (-)
CI01000046_00777923_00780186 RPC11, POLR3K, POLR3K.S other downstream 527971 774434 ~ 780293 (-)
G195098 NA other downstream 632136 670736 ~ 676128 (-)
G195097 NA other downstream 881938 407423 ~ 426326 (-)
CI01000046_00063416_00065082 NA other downstream 1242353 63153 ~ 65082 (-)
G196463 NA other upstream 859705 2168266 ~ 2168644 (-)
CI01000046_02866255_02867695 MRM2, FTSJ2 other upstream 1557698 2866070 ~ 2867794 (-)
G198265 NA other upstream 2449062 3665243 ~ 3800101 (-)
G199054 NA other upstream 4788798 6097359 ~ 6097674 (-)
G199014 NA other upstream 5055617 6364178 ~ 6375406 (-)

Expression


Co-expression Network