G198002


Basic Information

Item Value
gene id G198002
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 3016460 ~ 3016829 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU224729
ATCACAAGTAGATGAGGGAAACACATTCCCGTTTACACCTGGTGTTTTAAACCATCTCTTTTGTCCACTTTCTACAACTTCTGTCCTGATTTCTTCGAGGGGAGGGTCTATGGGTGGGTAAATGTATGGGTTATTTTTAGATCTTTCGATCTAATGGACAAAATAAGCTTACGCAATTTACATATGAAAGCGCCCGGAGACGATGGAAAAACACGGAGAGCATCAGCTTTCGTTTCTGCTCTGATAGCCGCAAGACCACGGCAAATGCTGTGAGTGAGTGTTAGAAATCAGGAATGGTGAGAGAACATTGTGCTTGGTACATTTTTCATCTTCAAACCAAGCTTGTTTCCAGCCAACCAAGTTTAAATCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU224729 True 370 lncRNA 0.42 1 3016460 3016829

Neighbor

gene id symbol gene type direction distance location
CI01000046_02972183_02978771 LFNG coding downstream 37689 2972183 ~ 2978771 (-)
CI01000046_02873360_02887683 SNX8A, SNX8 coding downstream 128777 2872981 ~ 2887683 (-)
CI01000046_02866255_02867695 MRM2, FTSJ2 coding downstream 148765 2866070 ~ 2867794 (-)
CI01000046_02480126_02480593 PSMG3 coding downstream 534519 2479876 ~ 2481941 (-)
CI01000046_02458763_02477098 TMEM184A coding downstream 539362 2458472 ~ 2477098 (-)
CI01000046_03067420_03068783 CHST12A, CHST12 coding upstream 50538 3067367 ~ 3068783 (-)
CI01000046_03080433_03083966 EIF3B, EIF3BA coding upstream 63604 3080433 ~ 3084292 (-)
CI01000046_03095399_03129278 GNA12, GNA12A coding upstream 78124 3094953 ~ 3129652 (-)
CI01000046_03140684_03161621 CARD11 coding upstream 123553 3140382 ~ 3161621 (-)
CI01000046_03606941_03615212 MMD2, MMD2A coding upstream 589888 3606717 ~ 3615212 (-)
G197978 NA non-coding downstream 49484 2966752 ~ 2966976 (-)
G197976 NA non-coding downstream 54214 2961990 ~ 2962246 (-)
G196692 NA non-coding downstream 240784 2775371 ~ 2775676 (-)
G196500 NA non-coding downstream 733926 2282268 ~ 2282534 (-)
G196479 NA non-coding downstream 784271 2231938 ~ 2232189 (-)
G198012 NA non-coding upstream 31350 3048179 ~ 3048425 (-)
G198013 NA non-coding upstream 32272 3049101 ~ 3049519 (-)
G198014 NA non-coding upstream 32791 3049620 ~ 3049840 (-)
G198020 NA non-coding upstream 40901 3057730 ~ 3057946 (-)
G198044 NA non-coding upstream 165256 3182085 ~ 3211294 (-)
G196463 NA other downstream 847816 2168266 ~ 2168644 (-)
CI01000046_00777923_00780186 RPC11, POLR3K, POLR3K.S other downstream 2236167 774434 ~ 780293 (-)
G195098 NA other downstream 2340332 670736 ~ 676128 (-)
G195097 NA other downstream 2590134 407423 ~ 426326 (-)
G198265 NA other upstream 740794 3665243 ~ 3800101 (-)
G199054 NA other upstream 3080530 6097359 ~ 6097674 (-)
G199014 NA other upstream 3347349 6364178 ~ 6375406 (-)
G199130 NA other upstream 3561151 6577980 ~ 6594210 (-)
G199181 NA other upstream 3809856 6826685 ~ 6830453 (-)

Expression


Co-expression Network