G198572



Basic Information


Item Value
gene id G198572
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 4449702 ~ 4449936 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU225394
TCTGGATACGGAGGTATTCCAACAAGGCAAAATGCAACTCCATTCATTGGACAGCTTAACTTGTTTTGTAGGGGGATCCGGGGGGTCGCGATTAAGATTATTGTGAAAGAAGTGTGCTATGAGCTATTTATCTTAAACCGTGGCGTTCACCTATCCAGTTTTCTTCCGCCCGCTCGTCTCTTTCCCGTTGTTTGCCCGCAGTGCCCTCCCTTTTCCCTCGCCCGATGCAAATCCG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU225394 True 235 lncRNA 0.49 1 4449702 4449936

Neighbor


gene id symbol gene type direction distance location
CI01000046_04440916_04442340 NA coding downstream 7343 4440558 ~ 4442359 (-)
CI01000046_04415076_04421680 NA coding downstream 28012 4414770 ~ 4421690 (-)
CI01000046_04374630_04379582 NA coding downstream 70114 4374510 ~ 4379588 (-)
CI01000046_04352237_04355463 ALDOAA, ALDOA, ALD, ALDOAB coding downstream 94211 4351849 ~ 4355491 (-)
CI01000046_04345411_04345806 NA coding downstream 103896 4345202 ~ 4345806 (-)
CI01000046_04640883_04644188 TMEM98 coding upstream 189297 4639233 ~ 4644521 (-)
CI01000046_04647083_04657110 NA coding upstream 196574 4646505 ~ 4657274 (-)
CI01000046_04685212_04689255 NA coding upstream 235249 4685185 ~ 4689375 (-)
CI01000046_04704175_04710872 NA coding upstream 253426 4703362 ~ 4710872 (-)
CI01000046_04777328_04800857 NA coding upstream 327392 4777328 ~ 4800857 (-)
G198604 NA non-coding downstream 396 4448903 ~ 4449306 (-)
G198603 NA non-coding downstream 2478 4446960 ~ 4447224 (-)
G198602 NA non-coding downstream 3446 4445720 ~ 4446256 (-)
G198601 NA non-coding downstream 4168 4445254 ~ 4445534 (-)
G198600 NA non-coding downstream 4562 4444910 ~ 4445140 (-)
G198605 NA non-coding upstream 1266 4451202 ~ 4451511 (-)
G198606 NA non-coding upstream 1626 4451562 ~ 4451882 (-)
G198607 NA non-coding upstream 3236 4453172 ~ 4453394 (-)
G198608 NA non-coding upstream 4633 4454569 ~ 4454876 (-)
G198609 NA non-coding upstream 5232 4455168 ~ 4455377 (-)
G198265 NA other downstream 649601 3665243 ~ 3800101 (-)
CI01000046_02866255_02867695 MRM2, FTSJ2 other downstream 1581908 2866070 ~ 2867794 (-)
G196463 NA other downstream 2281058 2168266 ~ 2168644 (-)
CI01000046_00777923_00780186 RPC11, POLR3K, POLR3K.S other downstream 3669409 774434 ~ 780293 (-)
G195098 NA other downstream 3773574 670736 ~ 676128 (-)
G199054 NA other upstream 1647423 6097359 ~ 6097674 (-)
G199014 NA other upstream 1914242 6364178 ~ 6375406 (-)
G199130 NA other upstream 2128044 6577980 ~ 6594210 (-)
G199181 NA other upstream 2376749 6826685 ~ 6830453 (-)

Expression



Co-expression Network