G202382


Basic Information

Item Value
gene id G202382
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 6815717 ~ 6816118 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU229634
GCCAACAGGTCGATGGACTGAGATGGAACAAGGGAAACTGAGACCAGAGGCGGAGTCACAGGATCCTCTGGTGACGTCCCGGCAGGGCATCTCCACAGACGGCGCAGGGCTGCAAGCTTCTAGCAGTAGCAGGACTGGAGGACTGGCTGAGCTCTGTGAAGGAGGTGACATCAGACTGGACAGGATGATGGTGAGTACGGCACAGTCCCGTTCCCTCGGCCGTAGATGTCGTGGGCTCACACCCCTGGTAAGACTCACTCAGGGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU229634 True 266 TUCP 0.60 2 6815717 6816118

Neighbor

gene id symbol gene type direction distance location
CI01000047_06783643_06786348 NA coding upstream 28173 6783477 ~ 6787544 (+)
CI01000047_06728778_06773150 ABCC3 coding upstream 42553 6728778 ~ 6773164 (+)
CI01000047_06561428_06565542 NA coding upstream 249975 6561386 ~ 6565742 (+)
CI01000047_06519975_06552961 MPRIP coding upstream 262753 6519876 ~ 6552964 (+)
CI01000047_06506053_06510048 NA coding upstream 305423 6505402 ~ 6510294 (+)
CI01000047_06983414_06988271 NA coding downstream 167212 6983330 ~ 6988361 (+)
CI01000047_07055609_07058426 NA coding downstream 239491 7055609 ~ 7058492 (+)
CI01000047_07058610_07069169 NA coding downstream 242492 7058610 ~ 7070864 (+)
CI01000047_07113397_07115657 ADPRM coding downstream 296035 7112153 ~ 7115977 (+)
CI01000047_07119977_07126126 MAP2K4B, MAP2K4 coding downstream 303859 7119977 ~ 7128054 (+)
G202167 NA non-coding upstream 8255 6765300 ~ 6807462 (+)
G202353 NA non-coding upstream 95540 6719719 ~ 6720177 (+)
G202347 NA non-coding upstream 112673 6702829 ~ 6703044 (+)
G202150 NA non-coding upstream 146741 6622609 ~ 6668976 (+)
G202129 NA non-coding upstream 217079 6592135 ~ 6598638 (+)
G202397 NA non-coding downstream 22144 6838262 ~ 6838926 (+)
G202398 NA non-coding downstream 24958 6841076 ~ 6841400 (+)
G202399 NA non-coding downstream 25451 6841569 ~ 6841821 (+)
G202434 NA non-coding downstream 76684 6892802 ~ 6893272 (+)
G202435 NA non-coding downstream 77340 6893458 ~ 6893674 (+)
G201599 NA other upstream 2333260 4415813 ~ 4482457 (+)
G201387 NA other upstream 3113857 3696516 ~ 3701860 (+)
G201186 NA other upstream 3727530 3018705 ~ 3088187 (+)
G200076 NA other upstream 4237720 2520596 ~ 2577997 (+)
G200003 NA other upstream 4496755 2316863 ~ 2318962 (+)

Expression


Co-expression Network