G223858


Basic Information

Item Value
gene id G223858
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000052
NCBI id null
chromosome length 3494004
location 2509139 ~ 2509435 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU253924
CTCAGAAAATTAGAATATTGTGAAAAGGTTCAATATTGAAGACACCTGGTGCCACACTCTAATCAGCTAATTAACTCAAAACACCTGCAAAGGCCTTTAAATGGTCTCTCAGTCTAGTTCTGTAGGCTACACAATCATGGGGAAGACTGCTGACTTGACAGTTGTCCAAAAGACGACCATTGACACCTTGCACAAGGAGGGCAAGACACAAAAGGTCATTGCAAAAGAGGCTGGCTGTTCACAGAGCTCTGCGTCCAAGCACATTAATAGAGAGGCGAAGGGAAGGAAAAGATGTGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU253924 True 297 lncRNA 0.44 1 2509139 2509435

Neighbor

gene id symbol gene type direction distance location
CI01000052_02468269_02501109 HMCN2 coding upstream 7965 2468269 ~ 2501174 (+)
CI01000052_02439580_02463549 HMCN2 coding upstream 43466 2439580 ~ 2465673 (+)
CI01000052_02417407_02438433 HMCN2 coding upstream 70215 2417372 ~ 2438924 (+)
CI01000052_02397395_02408461 MGC78985, NCS1A, NCS1B, NCS1.L, NCS1 coding upstream 100600 2397395 ~ 2408539 (+)
CI01000052_02374792_02389760 NA coding upstream 119036 2374712 ~ 2390103 (+)
CI01000052_02591303_02592790 NA coding downstream 79424 2588859 ~ 2592797 (+)
CI01000052_02597704_02601005 NA coding downstream 88121 2597556 ~ 2601852 (+)
CI01000052_02622010_02627854 NA coding downstream 110806 2620241 ~ 2628310 (+)
CI01000052_02646977_02647792 NA coding downstream 136788 2646223 ~ 2647824 (+)
CI01000052_02845585_02849894 NA coding downstream 336115 2845550 ~ 2849978 (+)
G223808 NA non-coding upstream 93250 2415167 ~ 2415889 (+)
G223806 NA non-coding upstream 94422 2411308 ~ 2414717 (+)
G223801 NA non-coding upstream 102784 2371701 ~ 2371846 (+)
G223843 NA non-coding upstream 147691 2361044 ~ 2361448 (+)
G223834 NA non-coding upstream 182321 2326583 ~ 2326818 (+)
G223863 NA non-coding downstream 7164 2516599 ~ 2516889 (+)
G223864 NA non-coding downstream 8043 2517478 ~ 2518007 (+)
G223865 NA non-coding downstream 9969 2519404 ~ 2519641 (+)
G223866 NA non-coding downstream 10767 2520202 ~ 2525774 (+)
G223694 NA other upstream 404840 2049326 ~ 2104299 (+)
G223545 NA other upstream 1238212 1270492 ~ 1270927 (+)
G224953 NA other downstream 921701 3431136 ~ 3460136 (+)

Expression


Co-expression Network