CI01000053_02029813_02031204 (CLTCB, CLTC)


Basic Information

Item Value
gene id CI01000053_02029813_02031204
gene name CLTCB, CLTC
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 2029813 ~ 2031790 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000053_02029813_02031204.mRNA
AGTGAAGGATTCATTCATTTAAAAGATTCGTTCAAAAACAACGATTCGTTCTCGAACGCACCACCACACTAGAGCGCAGCCGGAACTGACGTACATAGAATATGAAGAACTGAATGATGTGGCAAAAAAGAAACGAATTATTTAACATTTACTAGACTACTCATACCGGCGCTTATAAATCAAATCTAAAATATTAAATGCCCAAACGCTTACATACACCAAATTAGAGCTTCGCTCGTCTCTCGCTTGATTAGAAAAACCGCTAAAATCGCGAATGTCCTTCCGCCGCAAAGTCCGCGCTGCTGCTTCCGGATTGTCAGTCTGAGCTGTTTCCGCCGCCATTGCGGGTCTGAGCGAGTCCCATCCGTGCAGAGAGGGGAGGAAAAAAACATCAACCATCTGGCGGATTGGCTTGACACGACGAAAACACGACATTTTCATTCTCTGTCTAATATAACCAGCAGTCCTGCATTTGATCTGTTTTGAATCGAGGGTGTCCGCGGAGAGGAGGTCGTCGCTCGCTAAAGCTAGTGAGAAATTTTGCGAGGAGTCCGGCCGGGAGGATTGAGAACAGAAAGCCCAAACCATGGCTCAGATCCTTCCTATCCGCTTCCAGGAGCACCTGCAGCTCCAGAACCTGGGCATAAACCCAGCAAATATCGGGTTTAGCACCCTCACGATGGAGTCAGATAAGTTCATCTGCATTCGGGAAAAGGTGGGCGAACAGGCCCAGGTTGTGATCATTGACATGAGCGATCCCAATACGCCCATCCGCAGGCCCATCTCTGCAGACAGTGCCATCATGAACCCAGCCAGCAAAGTCATTGCTCTTAAAG

Function

symbol description
cltcb Predicted to enable clathrin light chain binding activity and structural molecule activity. Predicted to act upstream of or within intracellular protein transport and vesicle-mediated transport. Predicted to be located in clathrin-coated pit and cytoplasmic vesicle. Predicted to be part of clathrin coat of coated pit; clathrin coat of trans-Golgi network vesicle; and clathrin complex. Human ortholog(s) of this gene implicated in autosomal dominant mental retardation 56. Orthologous to human CLTC (clathrin heavy chain).
cltc Enables several functions, including clathrin light chain binding activity; disordered domain specific binding activity; and low-density lipoprotein particle receptor binding activity. Involved in several processes, including amyloid-beta clearance by transcytosis; negative regulation of hyaluronan biosynthetic process; and receptor-mediated endocytosis. Located in cytoplasmic vesicle; lysosome; and mitotic spindle microtubule. Part of clathrin complex. Implicated in autosomal dominant mental retardation 56.

GO:

id name namespace
GO:0016192 vesicle-mediated transport biological_process

KEGG:

id description
K04646 CLTC; clathrin heavy chain

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000053_02029813_02031204.mRNA True 836 mRNA 0.48 2 2029813 2031790

Neighbor

gene id symbol gene type direction distance location
CI01000053_02003828_02014352 CLTC coding downstream 15461 2002910 ~ 2014352 (-)
CI01000053_01982526_02001150 VMP1 coding downstream 28663 1982302 ~ 2001150 (-)
CI01000053_01964024_01971099 RPS6KB1B, RPS6KB1 coding downstream 58714 1963414 ~ 1971099 (-)
CI01000053_01932882_01958701 SNX19B coding downstream 69641 1932855 ~ 1960172 (-)
CI01000053_01847036_01856935 NA coding downstream 172583 1845726 ~ 1857230 (-)
CI01000053_02032534_02040859 DHX40 coding upstream 590 2032380 ~ 2041437 (-)
CI01000053_02041737_02066520 NA coding upstream 9900 2041690 ~ 2066658 (-)
CI01000053_02109802_02117454 NA coding upstream 77381 2109171 ~ 2117957 (-)
CI01000053_02122241_02132642 CLPTM1 coding upstream 89839 2121629 ~ 2132787 (-)
CI01000053_02145248_02149126 NA coding upstream 113388 2145178 ~ 2149381 (-)
G226542 NA non-coding downstream 97933 1931548 ~ 1931880 (-)
G226553 NA non-coding downstream 98476 1929839 ~ 1931337 (-)
G226614 NA non-coding downstream 253155 1776450 ~ 1776658 (-)
G226609 NA non-coding downstream 281726 1747880 ~ 1748087 (-)
G226645 NA non-coding upstream 31620 2063410 ~ 2063725 (-)
G226647 NA non-coding upstream 36741 2068531 ~ 2068740 (-)
G226649 NA non-coding upstream 51588 2083378 ~ 2083915 (-)
G226543 NA non-coding upstream 71603 2103393 ~ 2104463 (-)
G226657 NA non-coding upstream 74432 2106222 ~ 2106444 (-)
G225812 NA other downstream 563081 1459595 ~ 1466732 (-)
G225574 NA other downstream 1482945 543647 ~ 546868 (-)
CI01000053_02225226_02226481 YPELD, YPEL2B, YPEL1, YPELC, YPEL2 other upstream 185658 2225210 ~ 2226481 (-)
G226826 NA other upstream 534102 2565892 ~ 2567072 (-)
G226963 NA other upstream 964927 2996717 ~ 2997268 (-)
CI01000053_03551506_03551965 NA other upstream 1518543 3550333 ~ 3552847 (-)
G227604 NA other upstream 2055447 4087237 ~ 4087740 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location