G407429



Basic Information


Item Value
gene id G407429
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 4509122 ~ 4514347 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU468132
ACCTTTAAACAGATCTCTCTCATAGACCGGATCACTGGTCTCCTCACTCACTGCGTTCTTCAGTGTACAGCTGTAGAAGTTTTCTGGATTTCCTTCATTTTTGACTACTAAAGTCTCTCCTTTCGGATGGTGTTTTGAACCCATCAGTTCTTCTCCAGCAGAATTCTTCCAGTTTCTCTGTACTCACATATTAAATACACAACATCAGGGTTATCTTCACTCTTCTCTGTTTTTATCACAGGTTTGGGGACCCGCT

Function


NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU468132 True 256 lncRNA 0.42 2 4509122 4514347

Neighbor


gene id symbol gene type direction distance location
CI01000299_04456420_04468754 NA coding downstream 39672 4456229 ~ 4469450 (-)
CI01000299_04398464_04403711 NA coding downstream 105411 4393404 ~ 4403711 (-)
CI01000299_04370401_04385955 RADIL coding downstream 121102 4370401 ~ 4388020 (-)
CI01000299_04242809_04251680 ARGLU1 coding downstream 257257 4242197 ~ 4251865 (-)
CI01000299_04227918_04239792 EFNB2B coding downstream 269330 4227520 ~ 4239792 (-)
CI01000299_04587880_04594059 ATP1A1A.4, ATP1A1A.5, ATP1A1A.3, ATP1A1 coding upstream 73447 4587794 ~ 4594120 (-)
CI01000299_04603421_04609353 ATP1A1A.4, ATP1A1A.2, ATP1A1A.3, ATP1A1 coding upstream 89044 4603391 ~ 4609353 (-)
CI01000299_04645836_04651938 ATP1A1A.4, ATP1A1B, ATP1A1, ATP1A1A.1 coding upstream 131292 4645639 ~ 4651938 (-)
CI01000299_04658984_04668843 ATP1A1A.4, ATP1A1 coding upstream 144548 4658895 ~ 4669022 (-)
CI01000299_04708767_04714088 RCAN1B coding upstream 194156 4708503 ~ 4714088 (-)
G407416 NA non-coding downstream 27458 4480869 ~ 4481664 (-)
G407409 NA non-coding downstream 38907 4470012 ~ 4470215 (-)
G407408 NA non-coding downstream 42102 4466818 ~ 4467020 (-)
G407406 NA non-coding downstream 53442 4455446 ~ 4455680 (-)
G407434 NA non-coding upstream 9064 4523411 ~ 4547806 (-)
G407420 NA non-coding upstream 56784 4571131 ~ 4586048 (-)
G407467 NA non-coding upstream 122263 4636610 ~ 4637425 (-)
G407476 NA non-coding upstream 162763 4677110 ~ 4677446 (-)
G407477 NA non-coding upstream 163671 4678018 ~ 4678228 (-)
G405053 NA other downstream 2491072 2017687 ~ 2018050 (-)
G404976 NA other downstream 2628134 1855639 ~ 1880988 (-)
G404784 NA other downstream 2849122 1659655 ~ 1660000 (-)
G404372 NA other downstream 3433231 1070607 ~ 1075891 (-)
CI01000299_04913779_04927715 NA other upstream 411621 4913373 ~ 4927715 (-)
CI01000299_05428160_05443433 APP, APPA other upstream 926990 5427661 ~ 5443433 (-)
G407805 NA other upstream 1313489 5835889 ~ 5835989 (-)
CI01000299_06526127_06532048 CEP97 other upstream 2017654 6526127 ~ 6532048 (-)

Expression



Co-expression Network