XLOC_036521


Basic Information

Item Value
gene id XLOC_036521
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 29691710 ~ 29693950 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00072065
atcatccagtctttctggaatgacatgaagaaactaaatccataggaactttggcaacatttctaagatgtgcaaagtaaacgacagtaaacattggtaaatattcgctgctggccgtttagattcggccatgaactaacgttaatgttacgctaaaaacaaatgaaacaaaataaatataatctggttaatgcacaatttctaatcgtaacaatagccttatttactgacaacgatttactcacatgtgttacatggtgacaagacggagcaattccaaacgtcccaaaagtctgagcaaaacctcgtggcgtgctgctgcagtttgattcggatctttagaggcttcttgattcacaactcgtttgaatcaacgaatcagtaggcgcgtacctgaagtgatacaatatcgcgagatggattcaaatgcacacggagctgtctgttgttctcgcgatgttttgatgtcacactgatcggtttgttgaagacgaatcgattcaactctccgtcctccattcccagaatttcctgttcacggcagtacaaggacggcagcgcgagagcagcaagacccatgggatttcatcagccactcaccatcagagtcctcagtggaagctgagaagagcagaagaggaagccaagcaagagatgccagaaaaaaagggggaaggaaataatgtgttattttgctgtttgagtataggcaggtgcagtgggtagcacaatcgcctcacagcaagaaggtcgctggttcgagcctcggctgggtcagttggcatttctgtgtggagtttgcatgttctccccatgttagcgtgggtttcctccgggtgctcccacaagtccaaaaatatgtggtgacattgggtaaggtaaaattgtccgtagtgtatgtgtgtgaatgagtatgtatggatgtttcccagtgatgggttgcagctgggtggcaacacggtggcacagtaggtagtgctgtttcctcacatcaagaaggtttctgcatggagttctccctgcgttcgcgtgggtttcctccgggtgctccggtttccctcacagtccaaagacatgcggtacaggtgaattgggtagactaaattgtccgtagtgaatgcgtgtgagtgagtgtgtatggatgtttcccagagatgggttgcagctggaagggcatccactgcgtaaaacatatgctggataagatggtggtttattccactgtggcgaccccagattaacaaaaggacaaagccgaagagaaaatgaatgagtataggcaatgatagacaagacaatgtttgattaatatgaagtcttttaaaatgcttatttattaaaataaaggttac

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065007 biological regulation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044238 primary metabolic process biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0007369 gastrulation biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0050789 regulation of biological process biological_process
GO:0050794 regulation of cellular process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0043169 cation binding molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko03070 Bacterial secretion system
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00072065 True 1352 lncRNA 0.45 2 29691710 29693950

Neighbor

gene id symbol gene type direction distance location
XLOC_036519 prf1.6 coding downstream 14408 29670527 ~ 29677302 (-)
XLOC_036518 mpeg1.3 coding downstream 33539 29655948 ~ 29658171 (-)
XLOC_036517 AL807792.1 coding downstream 55787 29581495 ~ 29635923 (-)
XLOC_036516 NA coding downstream 963703 28726874 ~ 28728007 (-)
XLOC_036515 mc3r coding downstream 1036372 28654289 ~ 28655338 (-)
XLOC_036522 prf1.5 coding upstream 7478 29701428 ~ 29706882 (-)
XLOC_036523 mpeg1.1 coding upstream 16160 29710110 ~ 29713621 (-)
XLOC_036524 si:ch211-103n10.5 coding upstream 24742 29718692 ~ 29719393 (-)
XLOC_036525 slc20a2 coding upstream 76148 29770098 ~ 29851706 (-)
XLOC_036526 NA coding upstream 159279 29853229 ~ 29855017 (-)
XLOC_036514 NA non-coding downstream 1145034 28528329 ~ 28546676 (-)
XLOC_036513 NA non-coding downstream 1226257 28462504 ~ 28465453 (-)
XLOC_036506 BX664742.1 non-coding downstream 1395914 28294476 ~ 28295796 (-)
XLOC_036529 dre-mir-24-3 non-coding upstream 468542 30162492 ~ 30162633 (-)
XLOC_036530 dre-mir-27b non-coding upstream 473485 30167435 ~ 30167525 (-)
XLOC_036531 NA non-coding upstream 473680 30167630 ~ 30167704 (-)
XLOC_036536 NA non-coding upstream 1225999 30919949 ~ 30921272 (-)

Expression


Co-expression Network