AMCG00014679 (fgf14)


Basic Information

Item Value
gene id AMCG00014679
gene name fgf14
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 26681180 ~ 26698625 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014679
ATGGCAGCGGCGATTGCCAGCGGTTTGATCCGGCAGAAGAGACAGGCTCGGGAGCAGCATGCAGACCGGCCCTCCACCAATCGGAGGAGGAAAAGCCCCAGCAAGAACCGGGGTCTCTGCAATGGGAACCTGGTCGATATCTTCTCCAAAGTCCGAATCTTTGGCCTGAGGAAGAGGAGACTACGGAGACAAGTTCAGTTGTGGTTGATGCTAGCCAGTGCCAGTGTCAAGCAGGGGGTGCCCTCCCTCGCCAGACAGCTGCAGCAGAGCACAGGAATCCTGGTGGCAAACCAACAGCAACCTGCACTCCACCTCCTGCCCAAAAAAACAGCTCCAGCTCCTCTTTCCCTTTCTCCACCAGCCAAGGTCTCAGAGGAGATTCCTGCCAGCTCGAACAATCCCCAGCTCAAGGGTATAGTGACCAGGTTATATTGCAGGCAGGGATACTACTTGCAAATGCACCCAGATGGATCTCTTGATGGGACCAAGGATGACAGCACTTTGTTCAACCTCATACCAGTGGGCCTGAGAGTTGTTGCTATTCAGGCCGTGAAGACAGGGTTATACATAGCCATGAATGGAGAAGGTTATCTGTACACCTCA

Function

symbol description
fgf14 Predicted to enable sodium channel regulator activity. Predicted to be involved in regulation of voltage-gated sodium channel activity. Predicted to act upstream of or within nervous system development. Predicted to be located in extracellular region. Predicted to be active in cytoplasm and nucleus. Human ortholog(s) of this gene implicated in spinocerebellar ataxia type 27. Orthologous to human FGF14 (fibroblast growth factor 14).

NR:

description
fibroblast growth factor 14 isoform X3

GO:

id name namespace
GO:0007399 nervous system development biological_process
GO:0005576 extracellular region cellular_component
GO:0008083 growth factor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014679 True 603 mRNA 0.54 4 26681180 26698625

Neighbor

gene id symbol gene type direction distance location
AMCG00014678 fgf14 coding downstream 35248 26643240 ~ 26645932 (-)
AMCG00014672 NA coding downstream 141618 26522096 ~ 26539562 (-)
AMCG00014674 LOC102787851 coding downstream 200902 26428681 ~ 26480278 (-)
AMCG00014673 nalcn coding downstream 252651 26404082 ~ 26428529 (-)
AMCG00014671 tmtc4,LOC107600375 coding downstream 320189 26346500 ~ 26360991 (-)
AMCG00014686 NA coding upstream 203596 26902221 ~ 26904187 (-)
AMCG00014688 NA coding upstream 281496 26980121 ~ 27034019 (-)
AMCG00014689 shox,LOC102229599 coding upstream 480478 27179103 ~ 27189518 (-)
AMCG00014700 NA coding upstream 674447 27373072 ~ 27377772 (-)
AMCG00014699 NA coding upstream 682561 27381186 ~ 27386627 (-)
G71882 NA non-coding downstream 346180 26334655 ~ 26335000 (-)
G71880 NA non-coding downstream 356926 26324038 ~ 26324254 (-)
G71879 NA non-coding downstream 399215 26281374 ~ 26281965 (-)
G71876 NA non-coding downstream 412773 26267867 ~ 26268407 (-)
G71875 NA non-coding downstream 414964 26265731 ~ 26266216 (-)
G71961 NA non-coding upstream 233643 26932268 ~ 26932637 (-)
G72049 NA non-coding upstream 720191 27418816 ~ 27419045 (-)
G72089 NA non-coding upstream 831671 27530296 ~ 27530643 (-)
G72139 NA non-coding upstream 1137714 27836339 ~ 27837927 (-)
G72146 NA non-coding upstream 1158114 27856739 ~ 27861375 (-)
AMCG00014630 LOC107672672 other downstream 4436265 22225924 ~ 22244915 (-)
AMCG00014603 tpt1,LOC106582181 other downstream 7455950 19217722 ~ 19225230 (-)
AMCG00014604 kctd4,LOC107688678,LOC107748885 other downstream 7477613 19201803 ~ 19203567 (-)
AMCG00014567 mzt1,si:dkey-15d12.2 other downstream 8659085 17990651 ~ 18022095 (-)
AMCG00014559 NA other downstream 9060029 17589267 ~ 17621151 (-)
AMCG00014693 NA other upstream 586795 27285420 ~ 27304597 (-)
AMCG00014692 LOC107756725 other upstream 637070 27335695 ~ 27369527 (-)
G72236 rpl8,LOC107595836,LOC107748161 other upstream 1631114 28329739 ~ 28332482 (-)
G72477 LOC106598269,LOC101158751,LOC106586690,LOC103361283 other upstream 2690665 29389290 ~ 29398305 (-)
AMCG00014775 NA other upstream 4142898 30841523 ~ 30846800 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_037931 fgf14 coding NC_007120.7 CM002893.2 31838044 ~ 31915423 (-)
grasscarp (Ctenopharyngodon idella) CI01000009_01743393_01795392 FGF14 coding CI01000009 null 1743118 ~ 1795461 (-)