G121 (urp2,LOC107698908,LOC107555268,LOC107568775,LOC107718017,LOC107709382,LOC107653671)


Basic Information

Item Value
gene id G121
gene name urp2,LOC107698908,LOC107555268,LOC107568775,LOC107718017,LOC107709382,LOC107653671
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056699.1
NCBI id CM032068.1
chromosome length 31761587
location 888664 ~ 890056 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU170
GACCGATCGGACCGGTCACCGCCGAGAGGAGCTGGTGAAGATGCTGGGTGCTCTTGAAGAGCTTCACAAGTTGATGAACCGCACACTGAGCCATCGAATCACCATCATAACCAGAGGAAACAGCAACGGACGAAGTACTGGGAAGAAGAACAAAATGACAGTCACGGACGGAAACCTGAAATCTACCACAGCGACCACTATAGACGGTGGTGGGATTTCACCGAAGGCCAGCACTGATCAAATGGATCCTTAAACTCAACGGAAAAGCCTATAAAAAGTCTCTTCCGTCAGCTAAGAAAACCAACAAGCGAGTGTGCTTCTGGAAGTACTGCTCTCAGAACTGAGACGAGCTTCCCATTTC

Function

symbol description
urp2 Predicted to enable hormone activity. Predicted to act upstream of or within blood vessel diameter maintenance and regulation of blood pressure. Predicted to be located in extracellular region. Is expressed in nervous system.

NR:

description
PREDICTED: uncharacterized protein LOC107698908

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU170 True 361 lncRNA 0.37 4 888664 890056

Neighbor

gene id symbol gene type direction distance location
LOC122342042 LOC107746594,LOC107582328,LOC107686751 coding upstream 149742 729071 ~ 738922 (+)
LOC122337612 cd38,LOC107568972,LOC107693813 coding upstream 296323 567855 ~ 592341 (+)
LOC122341978 NA coding downstream 153127 1043183 ~ 1047811 (+)
ggact.3 NA coding downstream 153129 1043185 ~ 1045789 (+)
LOC122347479 LOC107730391,LOC107653668,LOC107677846,LOC107555244,LOC107746981,LOC107559791 coding downstream 355107 1245163 ~ 1250334 (+)
LOC122347468 LOC107653668,LOC107730391,LOC107746981,LOC107559791,LOC107677846,LOC107555244,LOC107730385 coding downstream 356637 1246693 ~ 1261968 (+)
LOC122351641 NA coding downstream 438329 1328385 ~ 1331549 (+)
G120 NA non-coding upstream 301 885518 ~ 888363 (+)
G84 NA non-coding upstream 265926 616164 ~ 622738 (+)
LOC122348571 NA non-coding upstream 413504 474039 ~ 475160 (+)
LOC122348617 NA non-coding upstream 421810 465920 ~ 466854 (+)
G69 NA non-coding upstream 446467 441899 ~ 442197 (+)
G128 NA non-coding downstream 20433 910489 ~ 910697 (+)
G141 NA non-coding downstream 160706 1050762 ~ 1083379 (+)
G162 kpnb3,ipo5,LOC107677849,LOC107653674,LOC107555240 non-coding downstream 236410 1126466 ~ 1128090 (+)
G138 NA non-coding downstream 236710 1126766 ~ 1212143 (+)
G139 rap2ab,rap2a,LOC105911819,LOC106512668,LOC106582448,LOC105933629,LOC101166017,LOC103391592 non-coding downstream 258330 1148386 ~ 1151169 (+)
LOC122341994 NA other upstream 439024 445940 ~ 449640 (+)
G10 NA other upstream 710464 177716 ~ 178200 (+)
G136 kpnb3,ipo5,LOC107730386,LOC107677849,LOC107555240,LOC107653674 other downstream 229663 1119719 ~ 1120721 (+)
LOC122327253 NA other downstream 548984 1439040 ~ 1441666 (+)
cyyr1 cyyr1,LOC107751099,LOC107698919,LOC107593871 other downstream 1295765 2185821 ~ 2192464 (+)
grtp1a grtp1,grtp1a,LOC107571994 other downstream 1593584 2483640 ~ 2489103 (+)
setdb2 LOC107570068 other downstream 1603516 2493572 ~ 2558527 (+)

Expression


Co-expression Network