G102334 (wdtc1,LOC107570846,LOC107673335)


Basic Information

Item Value
gene id G102334
gene name wdtc1,LOC107570846,LOC107673335
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056712.1
NCBI id CM032081.1
chromosome length 26701998
location 26038576 ~ 26040075 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU151258
CTGCTCTCCGCCCATGTTGACCAGCAGCTCGGTGCCGTCGGGACTGAACGTGACGTACGTGGCCACCAGAACCCGTAGTCTGTTGTTGTAGTCGGGGAGCTTCACGGGTAAGTGACCCGCCACGTAGTACTGTCCGGCGCCGTCCGGGATCGACTTCTGCTTGTCGCAAAACGTGTGAACGCCGGCCGAGGTGCTCTGATTCATAGACTTCTGTGATTGTGGATCATTCTGATGTCGTAGAGCCGGACGAAGGGCCCGTTGGCTCCCACAGCCAGGTAGTTGTTGTCTCGAGGGTTAATGGCCAGACACTTGGCCTCCACCAGCTGCCCGCAGTACTCCGTCAGATCTATTAACACCTCGGACCGCTTGCTGCTCTCTCTCAGATCGTACTG

Function

symbol description
wdtc1 Predicted to be involved in negative regulation of fatty acid biosynthetic process. Predicted to be part of Cul4-RING E3 ubiquitin ligase complex. Predicted to be active in cytoplasm. Orthologous to human WDTC1 (WD and tetratricopeptide repeats 1).

NR:

description
PREDICTED: WD and tetratricopeptide repeats protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU151258 True 392 lncRNA 0.58 2 26038576 26040075

Neighbor

gene id symbol gene type direction distance location
nr0b2a LOC107738278,LOC107570854,LOC107673326,LOC107697581,LOC107555404,LOC107737292 coding upstream 32530 26003920 ~ 26006046 (+)
LOC122357970 pabpc1a,LOC107673332,LOC107737898,LOC108431046,LOC108256232 coding upstream 40285 25990764 ~ 25998291 (+)
LOC122357982 NA coding upstream 47558 25981040 ~ 25991018 (+)
LOC122357971 phldb3,LOC107565285,LOC107737291 coding upstream 58094 25957664 ~ 25980482 (+)
ethe1 ethe1 coding upstream 83876 25948216 ~ 25954700 (+)
LOC122357988 LOC107730291,LOC107673329,LOC107570855,LOC107697582,LOC107745168,LOC792958 coding downstream 28852 26068927 ~ 26074927 (+)
azi2 LOC107673336,LOC107745144,LOC107570847,LOC107570057,LOC107697570 coding downstream 36830 26076905 ~ 26088981 (+)
eomesb eomes,LOC107730287,LOC107673324,LOC107745170,LOC107697593,LOC107570058 coding downstream 76140 26116215 ~ 26121752 (+)
LOC122357542 ttc24 coding downstream 115564 26155639 ~ 26166583 (+)
LOC122357494 NA coding downstream 162778 26202853 ~ 26209478 (+)
G102286 NA non-coding upstream 144273 25803612 ~ 25894303 (+)
LOC122357999 NA non-coding upstream 206331 25830215 ~ 25832245 (+)
G102284 gpc2,LOC107716510,LOC107665619,LOC107573391 non-coding upstream 238385 25799205 ~ 25800191 (+)
G102212 NA non-coding upstream 281083 25757175 ~ 25757493 (+)
G102209 NA non-coding upstream 286440 25751779 ~ 25752136 (+)
G102335 NA non-coding downstream 6975 26047050 ~ 26056104 (+)
G102341 NA non-coding downstream 18088 26058163 ~ 26058439 (+)
G102344 NA non-coding downstream 45305 26085380 ~ 26090260 (+)
G102348 NA non-coding downstream 53770 26093845 ~ 26126060 (+)
G102352 NA non-coding downstream 59587 26099662 ~ 26101843 (+)
G102332 wdtc1,LOC107738793,LOC107673335 other upstream 2938 26032979 ~ 26035638 (+)
LOC122358267 LOC107593202,LOC107740141,LOC107680337,LOC107554835,LOC108268827,LOC105904295 other upstream 979376 25057752 ~ 25059200 (+)
G102017 LOC107680957,LOC107593209,LOC107740154,LOC100534741 other upstream 1821813 24216243 ~ 24216763 (+)
tmem35 tmem35a,tmem35,LOC107680989,LOC107740187,LOC107724834,LOC107688707 other upstream 1949054 24086724 ~ 24089522 (+)
nitr14b NA other upstream 2066327 23970152 ~ 23972249 (+)
gnrhr3 LOC107567517,LOC107673322,LOC108436550,LOC105908885 other downstream 128483 26168558 ~ 26175734 (+)
khdc4 kiaa0907,LOC107570803,LOC107565361,LOC107679549 other downstream 334258 26374333 ~ 26383784 (+)
LOC122357543 vps13b,LOC107570792,LOC107671824 other downstream 361452 26401527 ~ 26429629 (+)

Expression


Co-expression Network