RNA id: TU152232


Basic Information

Item Value
RNA id TU152232
length 225
lncRNA type read_through
GC content 0.63
exon number 3
gene id G103000
representative True

Chromosome Information

Item Value
chromosome id NC_056713.1
NCBI id CM032082.1
chromosome length 23709629
location 1348194 ~ 1404860 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

gtgaaggttgaggccgttgtccaggggaaaagtgtccaaataaaagggggatctggtgtcctcgtcgtgccacggggaaagtgaaggttgaggccgtgttccaggggggaagggtccaggtaaggggcggagtccggcggtcgcacacgctcccctttttctggtccggggcgcgaggggcggcggcttcttccgcggcgtcaccgtcgccgttaaatacctgac

Function

GO:

id name namespace
GO:0043627 response to estrogen biological_process
GO:0071391 cellular response to estrogen stimulus biological_process

KEGG:

id description
ko04141 Protein processing in endoplasmic reticulum

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU152193 lncRNA downstream 58054 1289464 ~ 1290140 (-) True G102970
TU152166 lncRNA downstream 219866 1124062 ~ 1128328 (-) True G102953
TU152055 lncRNA downstream 349999 996617 ~ 998195 (-) True G102862
TU152048 lncRNA downstream 359611 987579 ~ 988583 (-) True G102858
TU152043 lncRNA downstream 384245 957694 ~ 963949 (-) True G102855
TU152240 lncRNA upstream 76797 1481657 ~ 1485234 (-) True G103003
TU152336 lncRNA upstream 217824 1622684 ~ 1626733 (-) True G103080
TU152405 lncRNA upstream 336861 1741721 ~ 1744473 (-) True G103114
TU152354 lncRNA upstream 375458 1780318 ~ 1826017 (-) True G103090
TU152376 lncRNA upstream 384199 1789059 ~ 1828300 (-) False G103094
XM_043258676.1 mRNA downstream 31644 1296554 ~ 1316550 (-) False egln2
XM_043258675.1 mRNA downstream 31644 1296554 ~ 1316550 (-) False egln2
XM_043258674.1 mRNA downstream 31644 1296554 ~ 1316550 (-) True egln2
XM_043258227.1 mRNA downstream 55231 1290803 ~ 1292963 (-) True tmem160
XM_043259043.1 mRNA downstream 206519 1134145 ~ 1141675 (-) True ap2s1
XM_043259842.1 mRNA upstream 362193 1767053 ~ 1768071 (-) True LOC122359511
XM_043258363.1 mRNA upstream 397128 1801988 ~ 1807484 (-) False LOC122358522
XM_043258362.1 mRNA upstream 397128 1801988 ~ 1806971 (-) True LOC122358522
XM_043258353.1 mRNA upstream 473355 1878215 ~ 1882508 (-) True si:dkey-202l22.3
XM_043259659.1 mRNA upstream 484823 1889683 ~ 1896275 (-) True si:dkey-202l22.6
TU151874 other downstream 1246260 98628 ~ 101934 (-) False LOC122359153
TU152377 other upstream 372160 1777020 ~ 1789827 (-) True G103094
TU152433 other upstream 440139 1844999 ~ 1845494 (-) True G103130
XR_006252662.1 other upstream 733707 2138567 ~ 2156930 (-) True scn2b
TU152493 other upstream 802487 2207347 ~ 2291926 (-) True G103183
TU152527 other upstream 1269214 2674074 ~ 2675712 (-) False LOC122359207

Expression Profile