RNA id: TCONS_00018245


Basic Information

Item Value
RNA id TCONS_00018245
length 549
RNA type mRNA
GC content 0.52
exon number 3
gene id XLOC_009283
representative False

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 28006768 ~ 28085563 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCCTGCATCCAGGTGTCATATCTACGGAAATTGGAAGGTATATGGGTCCGCTACAGAAACTGCTTTGCCTGCCCATGTCGAAGCTGTTTTTCCTGGACCCTGAGGCAGGTGCGCAGACCACACTTTACTGTGCTTTGCAGGAGGGCCTGGAGCCTCTGAGTGGACGCTACTTCTCATCTTGCGCTCTGCAAGAAGTTGGTGCTTTGGGACGGGATGATGCTCTGGCCAGGAAGCTTTGGGATGTGAGCGAGAGACTGTGTGGCCTGTCCTGAATGAGCTCACACAGGACTCCAATGTTGCAGTATTGGTGGAAAATGGCTGCTAGCGATGAATTGACTTGTGCCTGCCTCCTGGGCTCTGTGCTGTCTGCTGTTGTGGGCTGAGCGACACGGTAAATGTCACTGATCGTCAAGCGCTTGTGCAATGGCTGCCCTTGCCAGAGAAAGTGCCGAGGTGGCAGATCCCGCCTTTGATTTAGACACTAAAGGCAGCAGAACAGCAAAAGCACTGAAGCATGAAGGTAAATTCTCATAATTCACAGCTGAAAGG

Function

GO:

id name namespace
GO:0042574 retinal metabolic process biological_process
GO:0005743 mitochondrial inner membrane cellular_component
GO:0052650 NADP-retinol dehydrogenase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-041114-134 Predicted to enable NADP-retinol dehydrogenase activity. Predicted to be involved in retinal metabolic process. Predicted to be active in mitochondrial inner membrane. Orthologous to human DHRS13 (dehydrogenase/reductase 13).

Ensembl:

ensembl_id ENSDART00000152620

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00019180 lncRNA downstream 50606 27784550 ~ 27956162 (-) False XLOC_009280
TCONS_00019181 lncRNA downstream 50749 27791127 ~ 27956019 (-) False XLOC_009280
TCONS_00019179 lncRNA downstream 122091 27784550 ~ 27884677 (-) False XLOC_009280
TCONS_00019178 lncRNA downstream 122091 27784550 ~ 27884677 (-) False XLOC_009280
TCONS_00019177 lncRNA downstream 122091 27784550 ~ 27884677 (-) False XLOC_009280
TCONS_00018263 lncRNA upstream 274535 28356845 ~ 28357872 (-) True XLOC_009291
TCONS_00019184 lncRNA upstream 417736 28500046 ~ 28541766 (-) True XLOC_009294
TCONS_00019185 lncRNA upstream 512233 28594543 ~ 28596484 (-) False XLOC_009296
TCONS_00018270 lncRNA upstream 512233 28594543 ~ 28596509 (-) True XLOC_009296
TCONS_00018273 lncRNA upstream 534414 28616724 ~ 28617733 (-) False XLOC_009297
TCONS_00018244 mRNA downstream 34294 27971298 ~ 27972474 (-) True XLOC_009282
TCONS_00018242 mRNA downstream 296193 27708739 ~ 27710575 (-) True XLOC_009279
TCONS_00018241 mRNA downstream 296255 27703409 ~ 27710513 (-) False XLOC_009279
TCONS_00018235 mRNA downstream 483930 27449423 ~ 27522838 (-) False XLOC_009274
TCONS_00018248 mRNA upstream 3883 28086193 ~ 28095532 (-) False XLOC_009285
TCONS_00018249 mRNA upstream 3883 28086193 ~ 28107505 (-) False XLOC_009285
TCONS_00018250 mRNA upstream 4384 28086694 ~ 28094326 (-) False XLOC_009285
TCONS_00018251 mRNA upstream 4388 28086698 ~ 28094327 (-) False XLOC_009285
TCONS_00018252 mRNA upstream 4624 28086934 ~ 28094325 (-) False XLOC_009285
TCONS_00018243 other downstream 83675 27922978 ~ 27923093 (-) True XLOC_009281
TCONS_00018240 other downstream 352476 27654176 ~ 27654292 (-) True XLOC_009277
TCONS_00018239 other downstream 360232 27646419 ~ 27646536 (-) True XLOC_009276
TCONS_00018201 other downstream 1708021 26298629 ~ 26298747 (-) True XLOC_009260
TCONS_00018200 other downstream 1732011 26274640 ~ 26274757 (-) True XLOC_009259
TCONS_00018264 other upstream 293203 28375513 ~ 28375627 (-) True XLOC_009292
TCONS_00018276 other upstream 652617 28734927 ~ 28735041 (-) True XLOC_009299
TCONS_00018305 other upstream 1302823 29385133 ~ 29386439 (-) True XLOC_009309
TCONS_00018320 other upstream 1587882 29670192 ~ 29670306 (-) True XLOC_009318
TCONS_00018322 other upstream 1794964 29877274 ~ 29877388 (-) True XLOC_009321

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000072_00453946_00487772.mRNA True 2837 mRNA 0.47 14 CI01000072 453741 ~ 488634 (+)