RNA id: TCONS_00021927


Basic Information

Item Value
RNA id TCONS_00021927
length 289
lncRNA type sense_over
GC content 0.49
exon number 3
gene id XLOC_009874
representative False

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 22618620 ~ 22678294 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGGGCAGATACAGAAGAGAGACTGGTGGAGCATCTTCTCAATCCAGCTCACTACAACAAACTGATCCGACCAGCTACTAATGGATCAGAAGTGGTGACAGTGCAGCTGATGGTCTCGCTGGCGCAGCTCATCAGTGTGCACGAGAGAGAACAGATCATGACCACCAATGTCTGGCTTACACAGGAATGGCAGGACTACAGACTAACATGGAGCCCAGAAGAGTTTGATGGCATGAAGAAGGTCCGTCTTCCCTCCAAGCATATTTGGCTGCCTGATGTTGTTCTTTA

Function

GO:

id name namespace
GO:0042391 regulation of membrane potential biological_process
GO:0050877 nervous system process biological_process
GO:0034220 ion transmembrane transport biological_process
GO:0007268 chemical synaptic transmission biological_process
GO:0006811 ion transport biological_process
GO:0007165 signal transduction biological_process
GO:0043005 neuron projection cellular_component
GO:0045202 synapse cellular_component
GO:0005886 plasma membrane cellular_component
GO:0005887 integral component of plasma membrane cellular_component
GO:0045211 postsynaptic membrane cellular_component
GO:0030054 cell junction cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0022848 acetylcholine-gated cation-selective channel activity molecular_function
GO:0004888 transmembrane signaling receptor activity molecular_function
GO:0005216 ion channel activity molecular_function
GO:0005230 extracellular ligand-gated ion channel activity molecular_function
GO:0030594 neurotransmitter receptor activity molecular_function

KEGG:

id description
ko04080 Neuroactive ligand-receptor interaction
ko04725 Cholinergic synapse
ko05207 Chemical carcinogenesis - receptor activation
ko05033 Nicotine addiction
ko04040 Ion channels

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00021710 lncRNA upstream 70537 22575355 ~ 22579326 (+) True XLOC_009872
TCONS_00021926 lncRNA upstream 72709 22575143 ~ 22577154 (+) False XLOC_009872
TCONS_00021925 lncRNA upstream 320835 22327970 ~ 22329028 (+) True XLOC_009870
TCONS_00021924 lncRNA upstream 322361 22323766 ~ 22327502 (+) True XLOC_009869
TCONS_00021923 lncRNA upstream 535927 22022533 ~ 22113936 (+) True XLOC_009868
TCONS_00021928 lncRNA downstream 40139 22695226 ~ 22696496 (+) True XLOC_009875
TCONS_00019708 lncRNA downstream 217773 22872860 ~ 22876095 (+) True XLOC_009877
TCONS_00019712 lncRNA downstream 639599 23294686 ~ 23297206 (+) True XLOC_009879
TCONS_00021929 lncRNA downstream 1156514 23811601 ~ 23821746 (+) False XLOC_009891
TCONS_00019740 lncRNA downstream 1258995 23914082 ~ 23915127 (+) True XLOC_009894
TCONS_00019698 mRNA upstream 46509 22587733 ~ 22603354 (+) True XLOC_009873
TCONS_00019697 mRNA upstream 46673 22587661 ~ 22603190 (+) False XLOC_009873
TCONS_00019696 mRNA upstream 288644 22345513 ~ 22361219 (+) True XLOC_009871
TCONS_00019693 mRNA upstream 711819 21918503 ~ 21938044 (+) True XLOC_009867
TCONS_00019692 mRNA upstream 711848 21917673 ~ 21938015 (+) False XLOC_009867
TCONS_00019703 mRNA downstream 106759 22761846 ~ 22790881 (+) True XLOC_009876
TCONS_00019704 mRNA downstream 209226 22864313 ~ 22881338 (+) False XLOC_009877
TCONS_00019705 mRNA downstream 209635 22864722 ~ 22872525 (+) False XLOC_009877
TCONS_00019706 mRNA downstream 210855 22865942 ~ 22879192 (+) False XLOC_009877
TCONS_00019707 mRNA downstream 210876 22865963 ~ 22872178 (+) False XLOC_009877
TCONS_00019682 other upstream 946184 21699006 ~ 21703679 (+) False XLOC_009863
TCONS_00019667 other upstream 1736379 20913413 ~ 20913484 (+) True XLOC_009854
TCONS_00019658 other upstream 2144998 20496773 ~ 20504865 (+) True XLOC_009846
TCONS_00019655 other upstream 2345588 20296823 ~ 20304275 (+) True XLOC_009845
TCONS_00019651 other upstream 2479035 20167834 ~ 20170828 (+) True XLOC_009843
TCONS_00019718 other downstream 742714 23397801 ~ 23399160 (+) False XLOC_009882
TCONS_00019728 other downstream 952144 23607231 ~ 23607352 (+) True XLOC_009889
TCONS_00019735 other downstream 1182833 23837920 ~ 23854611 (+) False XLOC_009892
TCONS_00019751 other downstream 1305784 23960871 ~ 23962929 (+) False XLOC_009898
TCONS_00019767 other downstream 1861005 24516092 ~ 24517092 (+) False XLOC_009904

Expression Profile

//