RNA id: TCONS_00032055


Basic Information

Item Value
RNA id TCONS_00032055
length 162
RNA type mRNA
GC content 0.59
exon number 1
gene id XLOC_016260
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 16198735 ~ 16359042 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGCTCGTGGAGGCCAGCGGACGTCGACTCGGCAGGGCCTGGCTCACTTCCTGCTGCGCTGCAACCTCAGCCCGGAGGCCCAAAAGGTGGTGGTGTTCGTCATTATGATGTTGCTGGTCATCATCAACGTAGTGCTGATGTTCCTGCTGGCCTTCCAGTAG

Function

GO:

id name namespace
GO:0035556 intracellular signal transduction biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005085 guanyl-nucleotide exchange factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070912-575 Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to act upstream of or within intracellular signal transduction. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human ARHGEF4 (Rho guanine nucleotide exchange factor 4).

Ensembl:

ensembl_id ENSDART00000173758

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00032050 lncRNA downstream 189068 16021657 ~ 16027339 (-) True XLOC_016259
TCONS_00033794 lncRNA downstream 565817 15637219 ~ 15650590 (-) True XLOC_016258
TCONS_00033793 lncRNA downstream 1252188 14962493 ~ 14964219 (-) True XLOC_016248
TCONS_00033358 lncRNA downstream 1266781 14933798 ~ 14949626 (-) True XLOC_016246
TCONS_00033359 lncRNA upstream 149506 16366074 ~ 16376418 (-) True XLOC_016261
TCONS_00032058 lncRNA upstream 171401 16387969 ~ 16393313 (-) True XLOC_016262
TCONS_00032062 lncRNA upstream 286212 16502780 ~ 16505996 (-) False XLOC_016263
TCONS_00032061 lncRNA upstream 286212 16502780 ~ 16506010 (-) False XLOC_016263
TCONS_00032060 lncRNA upstream 286212 16502780 ~ 16506457 (-) False XLOC_016263
TCONS_00032047 mRNA downstream 56916 15993389 ~ 16159491 (-) False XLOC_016259
TCONS_00032048 mRNA downstream 57204 15994008 ~ 16159203 (-) False XLOC_016259
TCONS_00032049 mRNA downstream 152918 16021436 ~ 16063489 (-) False XLOC_016259
TCONS_00032046 mRNA downstream 653213 15389193 ~ 15563194 (-) True XLOC_016257
TCONS_00032044 mRNA downstream 853484 15341689 ~ 15362923 (-) False XLOC_016256
TCONS_00032056 mRNA upstream 149200 16365768 ~ 16380283 (-) False XLOC_016261
TCONS_00032057 mRNA upstream 167717 16384285 ~ 16449504 (-) False XLOC_016262
TCONS_00032066 mRNA upstream 331138 16547706 ~ 16565690 (-) False XLOC_016266
TCONS_00032067 mRNA upstream 331788 16548356 ~ 16562505 (-) False XLOC_016266
TCONS_00032070 mRNA upstream 668717 16885285 ~ 17044959 (-) False XLOC_016268
TCONS_00032040 other downstream 1108691 15102103 ~ 15107716 (-) True XLOC_016253
TCONS_00032037 other downstream 1183286 15028646 ~ 15033121 (-) True XLOC_016251
TCONS_00032033 other downstream 1221917 14994393 ~ 14994490 (-) True XLOC_016250
TCONS_00031998 other downstream 2961610 13252152 ~ 13254797 (-) True XLOC_016221
TCONS_00031991 other downstream 3991868 12224423 ~ 12224539 (-) True XLOC_016216
TCONS_00032063 other upstream 292256 16508824 ~ 16512422 (-) True XLOC_016264
TCONS_00032069 other upstream 399372 16615940 ~ 16616055 (-) True XLOC_016267
TCONS_00032073 other upstream 727704 16944272 ~ 16944391 (-) True XLOC_016269
TCONS_00032082 other upstream 1122850 17339418 ~ 17392808 (-) False XLOC_016272
TCONS_00032083 other upstream 1137263 17353831 ~ 17392719 (-) True XLOC_016272

Expression Profile

//