RNA id: TCONS_00006916



Basic Information


Item Value
RNA id TCONS_00006916
length 715
RNA type mRNA
GC content 0.50
exon number 5
gene id XLOC_003536
representative False

Chromosome Information


Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 30244356 ~ 30252098 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CATCATGGAGTACAGACTGCAGAACACGTTACTGTTAGCCATCCTGCTGGTGTCTCAAGGATGGCGAAAGCAACGATACATGGGCTGGAAAATCCTGCAAATGTGATTGCGATGATTCCTCCAGCAAGATGCTTTCCAAGGGTTCATCAAGTTGGCCACAGGAGATGGGCTGCATGCCAGAGTGTCCCTACCATAAACCTCTGGGTTTTGAGGCAGGATCTGTGGCTTCAGATCAGATCAGCTGCTCTAATGAAGACCAGTACACAGGCTGGTTCTCCTCCTGGACGCCAAACAGGGCAAGACTAAATAGCCAAGGATTTGGATGTGCCTGGCTGTCCAAGTTCCAGGACACCAGCCAGTGGCTTCAGATTGACCTGAAGGAGGTGAAAGTGGTTTCTGGTATCCTGACCCAGGGCCGCTGTGACTCTGATGAGTGGGTTACCAAGTACACTATGCAGTACCGCATTAATGACAATCTCAACTGGATCTACTACAAAGACCAAACTGGAAACAACAGGGTGTTCTATGGGAACTCTGACCGCTCTTCCACAGTCCAGAACCTGCTGCGTCCACCAATCGTAGCGCGCTACATCCGTATCCTCCCTCTTGGCTGGCACACTCGCATCGCCATGCGCTTGGAGCTGCTGCTTTGCATGAATAAATGCACCTGAGCTAGCTAATAAGCAAAGCCATTCCTAACTATTTCCTGTACACC

Function


GO:

id name namespace
GO:0005575 cellular_component cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-040801-171 Is expressed in brain and visual system. Human ortholog(s) of this gene implicated in X-linked juvenile retinoschisis 1 and retinoschisis. Orthologous to human RS1 (retinoschisin 1).

Ensembl:

ensembl_id ENSDART00000150080

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00008633 lncRNA upstream 140574 30091155 ~ 30103837 (+) False XLOC_003534
TCONS_00006909 lncRNA upstream 165440 30075212 ~ 30078971 (+) True XLOC_003533
TCONS_00006903 lncRNA upstream 262439 29979257 ~ 29981972 (+) True XLOC_003532
TCONS_00008632 lncRNA upstream 337582 29905248 ~ 29906829 (+) True XLOC_003530
TCONS_00008407 lncRNA upstream 653215 29590873 ~ 29591196 (+) True XLOC_003524
TCONS_00006918 lncRNA downstream 1371 30252940 ~ 30253555 (+) False XLOC_003537
TCONS_00006919 lncRNA downstream 1388 30252957 ~ 30253557 (+) True XLOC_003537
TCONS_00006926 lncRNA downstream 47134 30298703 ~ 30300054 (+) True XLOC_003541
TCONS_00006953 lncRNA downstream 796285 31047854 ~ 31055288 (+) True XLOC_003551
TCONS_00008634 lncRNA downstream 953417 31204986 ~ 31212769 (+) True XLOC_003554
TCONS_00006914 mRNA upstream 12278 30162407 ~ 30232133 (+) True XLOC_003535
TCONS_00006913 mRNA upstream 12787 30162407 ~ 30231624 (+) False XLOC_003535
TCONS_00006911 mRNA upstream 12885 30161168 ~ 30231526 (+) False XLOC_003535
TCONS_00006912 mRNA upstream 12947 30161699 ~ 30231464 (+) False XLOC_003535
TCONS_00006910 mRNA upstream 140451 30091155 ~ 30103960 (+) True XLOC_003534
TCONS_00006920 mRNA downstream 2399 30253968 ~ 30280857 (+) False XLOC_003538
TCONS_00006921 mRNA downstream 2399 30253968 ~ 30280958 (+) False XLOC_003538
TCONS_00006922 mRNA downstream 2987 30254556 ~ 30280116 (+) True XLOC_003538
TCONS_00006923 mRNA downstream 30572 30282141 ~ 30294085 (+) True XLOC_003539
TCONS_00006924 mRNA downstream 44013 30295582 ~ 30329055 (+) False XLOC_003540
TCONS_00006893 other upstream 672883 29566747 ~ 29571528 (+) True XLOC_003523
TCONS_00006890 other upstream 892190 29352101 ~ 29352221 (+) True XLOC_003521
TCONS_00006865 other upstream 2723838 27520456 ~ 27520573 (+) True XLOC_003503
TCONS_00006853 other upstream 3629824 26604611 ~ 26614587 (+) False XLOC_003495
TCONS_00006838 other upstream 4166350 26077947 ~ 26078061 (+) True XLOC_003488
TCONS_00006949 other downstream 720465 30972034 ~ 30997832 (+) False XLOC_003549
TCONS_00006950 other downstream 723202 30974771 ~ 30974892 (+) True XLOC_003550
TCONS_00006952 other downstream 763950 31015519 ~ 31024572 (+) True XLOC_003549
TCONS_00006967 other downstream 1373602 31625171 ~ 31671413 (+) False XLOC_003561
TCONS_00006968 other downstream 1395375 31646944 ~ 31668072 (+) True XLOC_003561

Expression Profile


//

Homologous


species RNA id representative length rna type GC content exon number chromosome id location
bowfin (Amia calva) AMCG00014172 True 618 mRNA 0.57 4 CM030128.1 3372298 ~ 3375153 (-)