G363531


Basic Information

Item Value
gene id G363531
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000158
NCBI id null
chromosome length 1938735
location 1247054 ~ 1247303 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU414648
GCAGGAAATATAATCAGGCGCTAAAAATACATCCCATTAAAAGTCCGTTGAACCAATGGGATCACTCGTGGTCCTTGAGGAAACCCGATTCCTGTGGGGACTCTTACCACACCGGACTTTTATAACCGGTCGCACATGCGCATTTAATTTTTTTTGCAATAACTAGTTTATTCACAAGGTGGCAACTGTGCCCTGGCGGTGTCGATTCACAAGGTAGTCAGAGAAAAACTGCATAAACAGAACAGACCGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU414648 True 250 lncRNA 0.45 1 1247054 1247303

Neighbor

gene id symbol gene type direction distance location
CI01000158_01221423_01241226 ATG10 coding upstream 5623 1221423 ~ 1241431 (+)
CI01000158_01216424_01216750 NA coding upstream 29817 1215763 ~ 1217237 (+)
CI01000158_00983889_00993672 RHOBTB2 coding upstream 253000 983889 ~ 994054 (+)
CI01000158_00955930_00956923 NA coding upstream 289289 955090 ~ 957765 (+)
CI01000158_00923138_00936354 FGFR1B coding upstream 309263 923138 ~ 937791 (+)
CI01000158_01271157_01297723 XRCC4 coding downstream 23854 1271157 ~ 1298361 (+)
CI01000158_01309383_01335186 VCAN coding downstream 62080 1309383 ~ 1335400 (+)
CI01000158_01392749_01393057 NA coding downstream 145446 1392749 ~ 1393285 (+)
CI01000158_01394592_01407483 RASA1B, RASA1, RASA1A coding downstream 146371 1393674 ~ 1408189 (+)
CI01000158_01442232_01445146 NA coding downstream 194884 1442187 ~ 1445826 (+)
G363528 NA non-coding upstream 34810 1211903 ~ 1212244 (+)
G363454 NA non-coding upstream 182748 1064025 ~ 1064306 (+)
G363453 NA non-coding upstream 184686 1062160 ~ 1062368 (+)
G363449 NA non-coding upstream 188810 1058022 ~ 1058244 (+)
G363448 NA non-coding upstream 190199 1056644 ~ 1056855 (+)
G363539 NA non-coding downstream 6104 1253407 ~ 1253642 (+)
G363391 NA non-coding downstream 179850 1427153 ~ 1447839 (+)
G363390 NA non-coding downstream 200998 1448301 ~ 1451463 (+)
G363378 NA non-coding downstream 204957 1452260 ~ 1453741 (+)
G363583 NA non-coding downstream 218682 1465985 ~ 1467081 (+)
CI01000158_01687966_01688623 CRYBA4 other downstream 440664 1687966 ~ 1688784 (+)

Expression


Co-expression Network