Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_011848

Basic Information

Item	Value
gene id	XLOC_011848
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007128.7
NCBI id	CM002901.2
chromosome length	53461100
location	3823109 ~ 3829826 (-)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00024520
CGCTGTTTCATCAGCTCTGATGTATTTCTGCGTTTCCCATCAGCCGCATTCAGGAGAAAGCCAAACCGACTATATCAACAGCAGTACTGCGGGTCAAATGGCGAAACCGTACGAGTTCAACTGGCAGAGGCCTGTTCCTCAGTTCATGCAGAAAGGAGCGTGTTTTGACAGATTTGATGAGGTATGAAGTTTTCTCAGATTCATTGATTGTTTTATTCGGTTTTGT

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00024520	True	226	lncRNA	0.45	2	3823109	3829826

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_011847	PLCB4	coding	downstream	7416	3717384 ~ 3815693 (-)
XLOC_011846	WSCD1	coding	downstream	519304	3281440 ~ 3303805 (-)
XLOC_011845	tmem151bb	coding	downstream	633039	3183276 ~ 3190070 (-)
XLOC_011844	NA	coding	downstream	772013	3020946 ~ 3051096 (-)
XLOC_011843	C17H14orf132	coding	downstream	877517	2902113 ~ 2945592 (-)
XLOC_011849	PLCB1	coding	upstream	11186	3841012 ~ 3986236 (-)
XLOC_011850	bmp2a	coding	upstream	397428	4227254 ~ 4231532 (-)
XLOC_011851	gdf3	coding	upstream	409611	4239437 ~ 4252248 (-)
XLOC_011852	napba	coding	upstream	467250	4297076 ~ 4318428 (-)
XLOC_011853	klhl10a	coding	upstream	556823	4386649 ~ 4396692 (-)
XLOC_011835	NA	non-coding	downstream	1386831	2430899 ~ 2436278 (-)
XLOC_011834	CABZ01058452.1	non-coding	downstream	1401080	2401258 ~ 2422029 (-)
XLOC_011832	CABZ01052589.1	non-coding	downstream	1657339	2165656 ~ 2165770 (-)
XLOC_011829	CABZ01063203.1	non-coding	downstream	1898218	1915788 ~ 1924891 (-)
XLOC_011854	NA	non-coding	upstream	1312559	5142385 ~ 5143041 (-)
XLOC_011855	NA	non-coding	upstream	1327545	5157371 ~ 5426458 (-)
XLOC_011856	NA	non-coding	upstream	1622487	5452313 ~ 5564131 (-)
XLOC_011859	NA	non-coding	upstream	1821285	5651111 ~ 5654012 (-)
XLOC_011864	NA	non-coding	upstream	2051251	5881077 ~ 5884928 (-)

Expression

Co-expression Network