G407318


Basic Information

Item Value
gene id G407318
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 4129003 ~ 4129220 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU467991
GAAGCCTGGAGAGGCACAGAATCCAAGCTGCTTGAAGTCTAGTGTGAAGTTTCTGAAGTCAATAATGATTTGGGGGGGCCGTGACGTCTGCTGGTGTTGGTCCATTGTGTTTTATCAAGTGCAGAGTCAATGCAGCCATCTTCCAGGAGATTTTGGAGCACTTTATGCTTCCATCTGCTGACAAGCTTTATGGAGATGCTGATTTCCTTTTCCAGCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU467991 True 218 lncRNA 0.47 1 4129003 4129220

Neighbor

gene id symbol gene type direction distance location
CI01000299_03492360_03492614 NA coding downstream 635859 3492214 ~ 3493144 (-)
CI01000299_03341031_03366645 KLF7, KLF7A, KLF7B coding downstream 762275 3340766 ~ 3366728 (-)
CI01000299_03206204_03214303 MDH1B coding downstream 914700 3206185 ~ 3214303 (-)
CI01000299_03104921_03106385 NA coding downstream 1022618 3104605 ~ 3106385 (-)
CI01000299_02951402_03057288 PARD3BA coding downstream 1071715 2951402 ~ 3057288 (-)
CI01000299_04136702_04142005 NA coding upstream 5600 4134820 ~ 4142125 (-)
CI01000299_04158468_04164223 MX2, MX1, MXB, MX, MXA coding upstream 28781 4158001 ~ 4164715 (-)
CI01000299_04171373_04175441 NA coding upstream 41929 4171149 ~ 4175441 (-)
CI01000299_04186183_04196219 MX1, MXB, MXA coding upstream 55747 4184967 ~ 4197884 (-)
CI01000299_04227918_04239792 EFNB2B coding upstream 98300 4227520 ~ 4239792 (-)
G407288 NA non-coding downstream 1363 4121679 ~ 4127640 (-)
G407306 NA non-coding downstream 62355 4066205 ~ 4066648 (-)
G407303 NA non-coding downstream 79176 4049542 ~ 4049827 (-)
G407280 NA non-coding downstream 91219 4034732 ~ 4037784 (-)
G407232 NA non-coding downstream 208182 3914021 ~ 3920821 (-)
G407296 NA non-coding upstream 27605 4156825 ~ 4179627 (-)
G407330 NA non-coding upstream 78577 4207797 ~ 4208154 (-)
G407340 NA non-coding upstream 130262 4259482 ~ 4263461 (-)
G407343 NA non-coding upstream 137134 4266354 ~ 4266553 (-)
G407344 NA non-coding upstream 137999 4267219 ~ 4267442 (-)
G405053 NA other downstream 2110953 2017687 ~ 2018050 (-)
G404976 NA other downstream 2248015 1855639 ~ 1880988 (-)
G404784 NA other downstream 2469003 1659655 ~ 1660000 (-)
G404372 NA other downstream 3053112 1070607 ~ 1075891 (-)
CI01000299_00670925_00672195 NA other downstream 3456147 670680 ~ 673625 (-)
G407413 NA other upstream 346774 4475994 ~ 4550721 (-)
CI01000299_04913779_04927715 NA other upstream 796748 4913373 ~ 4927715 (-)
CI01000299_05428160_05443433 APP, APPA other upstream 1312117 5427661 ~ 5443433 (-)

Expression


Co-expression Network