G412342


Basic Information

Item Value
gene id G412342
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 5936653 ~ 5937296 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU473641
CCTTTATGAACACTGACGGACAGAGTGACGGAAGTCTTCAAGTAACAGTTTGACCCTTTCAATGGGGGCCACAGCTGTCTTGGAGATGGCAGCGGCCACACCACCGGCCAAGAAATCCTTCAAGAAGCTGATTACTGCGTCAGACATGATGTCCTATCTCCTGGAAGACAATCTCACCACCAAAGGACCCTATAAGAACCCCTGAGACGCCCCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU473641 True 214 lncRNA 0.51 2 5936653 5937296

Neighbor

gene id symbol gene type direction distance location
CI01000300_05900360_05934284 NA coding downstream 2369 5900317 ~ 5934284 (-)
CI01000300_05852841_05879101 ACSL1, ACSL1A coding downstream 57552 5852841 ~ 5879101 (-)
CI01000300_05743542_05743913 NA coding downstream 192349 5743493 ~ 5744304 (-)
CI01000300_05490981_05504872 NA coding downstream 431732 5490198 ~ 5504921 (-)
CI01000300_05345787_05353985 FRG1 coding downstream 582668 5345710 ~ 5353985 (-)
CI01000300_05940815_05947079 NA coding upstream 3253 5940549 ~ 5947079 (-)
CI01000300_05956128_05961938 UFSP2 coding upstream 18718 5956014 ~ 5961938 (-)
CI01000300_05962858_05963880 NA coding upstream 25538 5962834 ~ 5964126 (-)
CI01000300_05966800_05976695 PDLIM3A, PDLIM3 coding upstream 28816 5966112 ~ 5976695 (-)
CI01000300_05982822_06013144 SORBS2A, SORBS2 coding upstream 45083 5982379 ~ 6013144 (-)
G412421 NA non-coding downstream 27029 5909424 ~ 5909624 (-)
G412419 NA non-coding downstream 30561 5905849 ~ 5906092 (-)
G412365 NA non-coding downstream 227747 5708440 ~ 5708906 (-)
G412339 NA non-coding downstream 232737 5703649 ~ 5703916 (-)
G411414 NA non-coding downstream 295165 5641202 ~ 5641488 (-)
G412376 NA non-coding upstream 39523 5976819 ~ 5977214 (-)
G412436 NA non-coding upstream 110941 6048237 ~ 6126873 (-)
G412448 NA non-coding upstream 157259 6094555 ~ 6094884 (-)
G412480 NA non-coding upstream 197186 6134482 ~ 6134733 (-)
G412502 NA non-coding upstream 223588 6160884 ~ 6161388 (-)
G412378 NA other downstream 175464 5711685 ~ 5761189 (-)
G411012 NA other downstream 1541532 4390320 ~ 4395121 (-)
CI01000300_04075307_04079312 NA other downstream 1854551 4074636 ~ 4080539 (-)
G410498 NA other downstream 2128446 3801139 ~ 3808207 (-)
G409775 NA other downstream 3072655 2863158 ~ 2863998 (-)
G412555 NA other upstream 277624 6214920 ~ 6215579 (-)
G412681 NA other upstream 715702 6652998 ~ 6690333 (-)
G413140 NA other upstream 2209236 8146532 ~ 8146889 (-)
CI01000300_08959695_08973598 UGDH, UGDH.L other upstream 3032152 8958963 ~ 8973750 (-)
G414498 NA other upstream 3720753 9658049 ~ 9713722 (-)

Expression


Co-expression Network