G425834


Basic Information

Item Value
gene id G425834
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 12694618 ~ 12694890 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU488996
TAGGCACTCCCAGCTGGGTGTCCGGGGACCGGCAGAGTGTTTGAGGTGAGAGGAGGAGGTGGAGGCAGAGCAGCAGGCGACGCAAACATATTGGTGTGATGAGGAAGAGTGGAGGGTGGTAGGGAGGGGGGGAAGGTGTGCGAAGCCGTAGGGTTCGCTGGCAGGGGCAGGGGGAAGGTCGCTGCTGCCCCAGTGGGGGCAGGTTGGTGATGGTGCAGATGAGGGACTGGAGAGGGGCCCGGGGGCTTCCCTGGAGTGCTGCTTCGACTACTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU488996 True 273 lncRNA 0.64 1 12694618 12694890

Neighbor

gene id symbol gene type direction distance location
CI01000304_12653236_12670625 CXADR coding upstream 23635 12652837 ~ 12670983 (+)
CI01000304_12601154_12621980 EHD1B, EHD1 coding upstream 72625 12600836 ~ 12621993 (+)
CI01000304_12583384_12588591 WDR74 coding upstream 105554 12583384 ~ 12589788 (+)
CI01000304_12569155_12569469 NA coding upstream 124884 12569155 ~ 12569734 (+)
CI01000304_12556446_12557806 FAUB, UBIM, FAU coding upstream 136542 12556446 ~ 12558076 (+)
CI01000304_12718988_12729338 NA coding downstream 23877 12718767 ~ 12729850 (+)
CI01000304_12744525_12773999 NA coding downstream 49169 12744059 ~ 12774312 (+)
CI01000304_12819247_12825161 NA coding downstream 123089 12817979 ~ 12825313 (+)
CI01000304_12828251_12839287 NA coding downstream 132424 12827314 ~ 12839991 (+)
CI01000304_13331382_13338351 RNFT1 coding downstream 636492 13331382 ~ 13339248 (+)
G425835 NA non-coding upstream 200 12693084 ~ 12694418 (+)
G425832 NA non-coding upstream 3556 12690429 ~ 12691062 (+)
G425831 NA non-coding upstream 4853 12689434 ~ 12689765 (+)
G425817 NA non-coding upstream 5542 12688849 ~ 12689076 (+)
G425816 NA non-coding upstream 6018 12686128 ~ 12688600 (+)
G425930 NA non-coding downstream 194441 12889331 ~ 13036691 (+)
G426266 NA non-coding downstream 384782 13079672 ~ 13079904 (+)
G426274 NA non-coding downstream 424019 13118909 ~ 13119304 (+)
G426278 NA non-coding downstream 428567 13123457 ~ 13123685 (+)
G426288 NA non-coding downstream 439258 13134148 ~ 13134657 (+)
G425718 NA other upstream 255532 12436554 ~ 12436605 (+)
CI01000304_10555326_10571933 NA other upstream 2138914 10555216 ~ 10572164 (+)
G424251 NA other upstream 2501723 10188822 ~ 10189404 (+)
G424246 NA other upstream 2567296 10116343 ~ 10127322 (+)
CI01000304_09564068_09565679 HRH2B other upstream 3129045 9561005 ~ 9565778 (+)
CI01000304_13578347_13595075 NA other downstream 861561 13578049 ~ 13595097 (+)
G426312 NA other downstream 1635158 14330048 ~ 14330886 (+)
G426828 NA other downstream 2254000 14948890 ~ 14950592 (+)
G427860 NA other downstream 3190564 15885454 ~ 15889591 (+)
G428017 NA other downstream 3388340 16083230 ~ 16083714 (+)

Expression


Co-expression Network